Incidental Mutation 'R7980:Cntnap1'
ID651164
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101188893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1283 (I1283V)
Ref Sequence ENSEMBL: ENSMUSP00000099398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000103109
AA Change: I1283V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: I1283V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
PIT4354001:Cntnap1 UTSW 11 101181297 missense probably damaging 1.00
PIT4466001:Cntnap1 UTSW 11 101177305 missense probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 splice site probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
R7152:Cntnap1 UTSW 11 101177326 missense probably damaging 1.00
R7297:Cntnap1 UTSW 11 101188634 missense probably benign 0.01
R7347:Cntnap1 UTSW 11 101185268 missense probably damaging 1.00
R7961:Cntnap1 UTSW 11 101178295 missense probably benign
R8307:Cntnap1 UTSW 11 101188876 missense possibly damaging 0.73
R8386:Cntnap1 UTSW 11 101182203 missense probably damaging 1.00
R8403:Cntnap1 UTSW 11 101177590 missense probably damaging 1.00
R8826:Cntnap1 UTSW 11 101186829 missense probably damaging 0.99
RF042:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101189563 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189592 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189596 unclassified probably benign
RF050:Cntnap1 UTSW 11 101189592 unclassified probably benign
Z1176:Cntnap1 UTSW 11 101182898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTGGAGCTATGCCACG -3'
(R):5'- AAAATTTATAGCTGCCTAGTCCTCC -3'

Sequencing Primer
(F):5'- TCTGAGGTGCCACCAGAACTTG -3'
(R):5'- GTCCTCCCCCAGCTAAATACTGATG -3'
Posted On2020-09-15