Incidental Mutation 'R7980:Map2k6'
ID651165
Institutional Source Beutler Lab
Gene Symbol Map2k6
Ensembl Gene ENSMUSG00000020623
Gene Namemitogen-activated protein kinase kinase 6
SynonymsMAP kinase kinase 6, SAPKK3, Prkmk6, MKK6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110399122-110525522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110499384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 248 (I248N)
Ref Sequence ENSEMBL: ENSMUSP00000020949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]
Predicted Effect
SMART Domains Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: I248N

DomainStartEndE-ValueType
S_TKc 53 314 2.82e-73 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: I248N

DomainStartEndE-ValueType
Pfam:Pkinase 53 288 4.3e-47 PFAM
Pfam:Pkinase_Tyr 53 289 1.2e-32 PFAM
Pfam:Kinase-like 57 274 7.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Map2k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Map2k6 APN 11 110496411 missense probably damaging 1.00
IGL01778:Map2k6 APN 11 110512869 intron probably benign
IGL02058:Map2k6 APN 11 110492583 missense probably damaging 1.00
IGL02580:Map2k6 APN 11 110490841 missense probably damaging 0.98
IGL03139:Map2k6 APN 11 110496473 splice site probably benign
Heartening UTSW 11 110492908 missense
Uplifting UTSW 11 110492562 missense probably damaging 1.00
R0230:Map2k6 UTSW 11 110496455 missense probably damaging 1.00
R0361:Map2k6 UTSW 11 110499509 missense probably damaging 0.99
R0634:Map2k6 UTSW 11 110494343 nonsense probably null
R1716:Map2k6 UTSW 11 110497901 missense probably damaging 1.00
R2214:Map2k6 UTSW 11 110496341 missense probably damaging 1.00
R2279:Map2k6 UTSW 11 110499464 missense probably damaging 1.00
R4610:Map2k6 UTSW 11 110499474 missense probably damaging 1.00
R4677:Map2k6 UTSW 11 110399394 utr 5 prime probably benign
R5299:Map2k6 UTSW 11 110492963 missense probably benign 0.03
R5761:Map2k6 UTSW 11 110399371 utr 5 prime probably benign
R5996:Map2k6 UTSW 11 110497906 missense possibly damaging 0.77
R6391:Map2k6 UTSW 11 110490877 critical splice donor site probably null
R6529:Map2k6 UTSW 11 110492562 missense probably damaging 1.00
R7020:Map2k6 UTSW 11 110506714 intron probably benign
R7345:Map2k6 UTSW 11 110492908 missense
R7681:Map2k6 UTSW 11 110497903 nonsense probably null
R8087:Map2k6 UTSW 11 110490176 missense probably benign 0.00
R8093:Map2k6 UTSW 11 110482585 missense probably benign
R8531:Map2k6 UTSW 11 110399349 start gained probably benign
R8834:Map2k6 UTSW 11 110492593 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGGCCCGGGTGTTATCAAG -3'
(R):5'- GCATAGATCTGTGAGTGCAGG -3'

Sequencing Primer
(F):5'- CCGGGTGTTATCAAGGAGCTC -3'
(R):5'- GAGTGCAGGGTTCTCTTACCAC -3'
Posted On2020-09-15