Mutagenetix > Incidental Mutation

Incidental Mutation 'R7980:Adamts12'

651176

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7980 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 11263337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 595 (C595Y)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061318
AA Change: C595Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: C595Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	A	G	4: 88,868,078	L101P	unknown	Het
5430419D17Rik	T	A	7: 131,234,777	V400E	probably damaging	Het
Actn3	G	A	19: 4,867,922	P339L	probably damaging	Het
Agl	A	T	3: 116,792,181	N99K	probably benign	Het
Aplp1	A	T	7: 30,435,567	M592K	probably benign	Het
Arhgef11	C	T	3: 87,697,990	R251C	probably benign	Het
Arhgef12	A	T	9: 42,971,299	C1416*	probably null	Het
Asah1	A	G	8: 41,354,030	M119T		Het
Asxl2	A	T	12: 3,496,630	Q471H	probably damaging	Het
Atp6v1c2	A	T	12: 17,321,612	D61E	probably damaging	Het
Btbd16	C	A	7: 130,824,367	P520Q	probably damaging	Het
Cacnb2	A	G	2: 14,604,515	E22G	probably benign	Het
Catspere2	G	T	1: 178,003,044		probably null	Het
Cdc25a	T	A	9: 109,879,881	D124E	probably damaging	Het
Cdc42se1	A	T	3: 95,231,855		probably benign	Het
Cfap54	T	C	10: 92,982,060	K1265E	possibly damaging	Het
Chaf1b	A	G	16: 93,884,527	H11R	probably damaging	Het
Chil4	T	C	3: 106,202,744	K345E	probably damaging	Het
Cntnap1	A	G	11: 101,188,893	I1283V	probably benign	Het
Dagla	C	T	19: 10,252,042	C618Y	possibly damaging	Het
Ddx19b	C	T	8: 111,011,445	V224M	possibly damaging	Het
Dohh	C	T	10: 81,387,892	R260*	probably null	Het
Dsg3	A	T	18: 20,531,360	N472Y	probably benign	Het
Duox1	T	A	2: 122,347,320	N1528K	possibly damaging	Het
Eml6	A	G	11: 29,833,205	Y559H	probably damaging	Het
Esp4	A	G	17: 40,602,301	T20A	possibly damaging	Het
Fbxw21	T	C	9: 109,156,571		probably null	Het
Gcc2	T	A	10: 58,278,752		probably null	Het
Gm9774	T	A	3: 92,429,099	K99*	probably null	Het
Grin3b	C	T	10: 79,975,725	A715V	possibly damaging	Het
Gxylt2	A	T	6: 100,787,209		probably null	Het
Hspa4	A	T	11: 53,280,577	S267T	probably benign	Het
Hspd1	A	G	1: 55,078,626	V491A	possibly damaging	Het
Idua	A	G	5: 108,680,620	E280G	probably benign	Het
Ift172	T	A	5: 31,260,644	E1267V	probably benign	Het
Itsn1	T	A	16: 91,905,294	V1448E	unknown	Het
Kat6a	A	G	8: 22,926,416	M647V	possibly damaging	Het
Kcnq4	A	T	4: 120,711,297	D407E	probably benign	Het
Kif1b	A	T	4: 149,269,921	F221I	probably damaging	Het
Lama2	G	T	10: 27,363,613	D315E	probably damaging	Het
Lrrn4	G	A	2: 132,878,176	L235F	probably damaging	Het
Map2k6	T	A	11: 110,499,384	I248N		Het
Mgat5	A	G	1: 127,479,511	Q638R	probably benign	Het
Mia2	A	G	12: 59,108,865	K455E	probably damaging	Het
Mrs2	A	G	13: 25,020,238	C3R	possibly damaging	Het
Nprl3	A	G	11: 32,237,357	I325T	probably damaging	Het
Nr1h3	T	A	2: 91,190,884	Q186L	probably benign	Het
Oas1f	A	G	5: 120,851,475	E159G	probably benign	Het
Olfr1024	A	G	2: 85,904,598	F152S	probably benign	Het
Olfr130	A	T	17: 38,067,521	M117L	possibly damaging	Het
Olfr460	T	A	6: 40,572,220	I278N	probably benign	Het
Olfr591	T	A	7: 103,173,035	S201C	probably damaging	Het
Olfr603	T	A	7: 103,383,763	I80F	probably damaging	Het
Olfr608	T	A	7: 103,470,297	F86Y	probably damaging	Het
Olfr725	T	A	14: 50,034,795	S203C	probably damaging	Het
Olfr967	T	C	9: 39,751,121	I245T	probably damaging	Het
Pbxip1	G	C	3: 89,446,341	S267T	probably benign	Het
Pcdhga10	A	T	18: 37,748,592	I469F	possibly damaging	Het
Pkd1l1	A	G	11: 8,854,375	S1739P	probably damaging	Het
Plcd4	A	C	1: 74,565,305	N788T	probably benign	Het
Pms2	T	A	5: 143,931,091	W838R	probably damaging	Het
Pnpla6	T	A	8: 3,536,562	V926D	probably damaging	Het
Pros1	A	T	16: 62,928,153	H663L	possibly damaging	Het
Prss55	T	C	14: 64,078,689		probably null	Het
Pum2	T	C	12: 8,713,904	Y283H	probably damaging	Het
Rad21	A	G	15: 51,965,026	S549P	probably benign	Het
Sap130	T	A	18: 31,648,129		probably null	Het
Sertad4	C	T	1: 192,846,881	S209N	probably benign	Het
Sez6	A	G	11: 77,953,842	T164A	probably benign	Het
Slc22a28	C	T	19: 8,101,473	R284Q	probably damaging	Het
Slco4c1	T	C	1: 96,836,925	K474R	probably benign	Het
Stx5a	T	C	19: 8,742,438	S56P	probably damaging	Het
Svopl	T	C	6: 38,014,809	T379A	probably damaging	Het
Sypl2	A	G	3: 108,217,692	F118L	probably damaging	Het
Tfrc	G	A	16: 32,617,149	V215M	probably benign	Het
Thnsl2	T	C	6: 71,138,668	N185S	probably damaging	Het
Tmem104	T	C	11: 115,243,754	I372T	probably damaging	Het
Tnfaip6	G	A	2: 52,051,058	G204S	probably damaging	Het
Trim12a	C	T	7: 104,304,128	E259K	probably benign	Het
Tubgcp6	G	A	15: 89,102,029	R1436C	probably benign	Het
Tyrp1	C	T	4: 80,840,627	L246F	probably damaging	Het
Ubr4	G	T	4: 139,418,406	V216F		Het
Unc5a	A	G	13: 54,999,506	I409V	possibly damaging	Het
Vmn1r15	T	C	6: 57,258,414	L89P	probably damaging	Het
Vmn1r32	A	T	6: 66,553,321	L157*	probably null	Het
Zcchc24	A	G	14: 25,719,761	Y160H	probably damaging	Het
Zfp184	A	T	13: 21,960,206	H694L	probably damaging	Het
Zfp345	A	C	2: 150,472,803	Y271*	probably null	Het
Zranb3	T	C	1: 128,102,934		probably benign	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGCTGATGAGAAACATATACACC -3'
(R):5'- CAGGGCTTCTGAGAAACTCC -3'

Sequencing Primer
(F):5'- CCCCCAAACAGTATGAAATTGGAAGG -3'
(R):5'- GGGCTTCTGAGAAACTCCAGATTC -3'

Posted On

2020-09-15