Mutagenetix > Incidental Mutation

Incidental Mutation 'R7980:Pros1'

651180

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7980 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62928153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 663 (H663L)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023629
AA Change: H663L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: H663L

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	A	G	4: 88,868,078	L101P	unknown	Het
5430419D17Rik	T	A	7: 131,234,777	V400E	probably damaging	Het
Actn3	G	A	19: 4,867,922	P339L	probably damaging	Het
Adamts12	G	A	15: 11,263,337	C595Y	probably damaging	Het
Agl	A	T	3: 116,792,181	N99K	probably benign	Het
Aplp1	A	T	7: 30,435,567	M592K	probably benign	Het
Arhgef11	C	T	3: 87,697,990	R251C	probably benign	Het
Arhgef12	A	T	9: 42,971,299	C1416*	probably null	Het
Asah1	A	G	8: 41,354,030	M119T		Het
Asxl2	A	T	12: 3,496,630	Q471H	probably damaging	Het
Atp6v1c2	A	T	12: 17,321,612	D61E	probably damaging	Het
Btbd16	C	A	7: 130,824,367	P520Q	probably damaging	Het
Cacnb2	A	G	2: 14,604,515	E22G	probably benign	Het
Catspere2	G	T	1: 178,003,044		probably null	Het
Cdc25a	T	A	9: 109,879,881	D124E	probably damaging	Het
Cdc42se1	A	T	3: 95,231,855		probably benign	Het
Cfap54	T	C	10: 92,982,060	K1265E	possibly damaging	Het
Chaf1b	A	G	16: 93,884,527	H11R	probably damaging	Het
Chil4	T	C	3: 106,202,744	K345E	probably damaging	Het
Cntnap1	A	G	11: 101,188,893	I1283V	probably benign	Het
Dagla	C	T	19: 10,252,042	C618Y	possibly damaging	Het
Ddx19b	C	T	8: 111,011,445	V224M	possibly damaging	Het
Dohh	C	T	10: 81,387,892	R260*	probably null	Het
Dsg3	A	T	18: 20,531,360	N472Y	probably benign	Het
Duox1	T	A	2: 122,347,320	N1528K	possibly damaging	Het
Eml6	A	G	11: 29,833,205	Y559H	probably damaging	Het
Esp4	A	G	17: 40,602,301	T20A	possibly damaging	Het
Fbxw21	T	C	9: 109,156,571		probably null	Het
Gcc2	T	A	10: 58,278,752		probably null	Het
Gm9774	T	A	3: 92,429,099	K99*	probably null	Het
Grin3b	C	T	10: 79,975,725	A715V	possibly damaging	Het
Gxylt2	A	T	6: 100,787,209		probably null	Het
Hspa4	A	T	11: 53,280,577	S267T	probably benign	Het
Hspd1	A	G	1: 55,078,626	V491A	possibly damaging	Het
Idua	A	G	5: 108,680,620	E280G	probably benign	Het
Ift172	T	A	5: 31,260,644	E1267V	probably benign	Het
Itsn1	T	A	16: 91,905,294	V1448E	unknown	Het
Kat6a	A	G	8: 22,926,416	M647V	possibly damaging	Het
Kcnq4	A	T	4: 120,711,297	D407E	probably benign	Het
Kif1b	A	T	4: 149,269,921	F221I	probably damaging	Het
Lama2	G	T	10: 27,363,613	D315E	probably damaging	Het
Lrrn4	G	A	2: 132,878,176	L235F	probably damaging	Het
Map2k6	T	A	11: 110,499,384	I248N		Het
Mgat5	A	G	1: 127,479,511	Q638R	probably benign	Het
Mia2	A	G	12: 59,108,865	K455E	probably damaging	Het
Mrs2	A	G	13: 25,020,238	C3R	possibly damaging	Het
Nprl3	A	G	11: 32,237,357	I325T	probably damaging	Het
Nr1h3	T	A	2: 91,190,884	Q186L	probably benign	Het
Oas1f	A	G	5: 120,851,475	E159G	probably benign	Het
Olfr1024	A	G	2: 85,904,598	F152S	probably benign	Het
Olfr130	A	T	17: 38,067,521	M117L	possibly damaging	Het
Olfr460	T	A	6: 40,572,220	I278N	probably benign	Het
Olfr591	T	A	7: 103,173,035	S201C	probably damaging	Het
Olfr603	T	A	7: 103,383,763	I80F	probably damaging	Het
Olfr608	T	A	7: 103,470,297	F86Y	probably damaging	Het
Olfr725	T	A	14: 50,034,795	S203C	probably damaging	Het
Olfr967	T	C	9: 39,751,121	I245T	probably damaging	Het
Pbxip1	G	C	3: 89,446,341	S267T	probably benign	Het
Pcdhga10	A	T	18: 37,748,592	I469F	possibly damaging	Het
Pkd1l1	A	G	11: 8,854,375	S1739P	probably damaging	Het
Plcd4	A	C	1: 74,565,305	N788T	probably benign	Het
Pms2	T	A	5: 143,931,091	W838R	probably damaging	Het
Pnpla6	T	A	8: 3,536,562	V926D	probably damaging	Het
Prss55	T	C	14: 64,078,689		probably null	Het
Pum2	T	C	12: 8,713,904	Y283H	probably damaging	Het
Rad21	A	G	15: 51,965,026	S549P	probably benign	Het
Sap130	T	A	18: 31,648,129		probably null	Het
Sertad4	C	T	1: 192,846,881	S209N	probably benign	Het
Sez6	A	G	11: 77,953,842	T164A	probably benign	Het
Slc22a28	C	T	19: 8,101,473	R284Q	probably damaging	Het
Slco4c1	T	C	1: 96,836,925	K474R	probably benign	Het
Stx5a	T	C	19: 8,742,438	S56P	probably damaging	Het
Svopl	T	C	6: 38,014,809	T379A	probably damaging	Het
Sypl2	A	G	3: 108,217,692	F118L	probably damaging	Het
Tfrc	G	A	16: 32,617,149	V215M	probably benign	Het
Thnsl2	T	C	6: 71,138,668	N185S	probably damaging	Het
Tmem104	T	C	11: 115,243,754	I372T	probably damaging	Het
Tnfaip6	G	A	2: 52,051,058	G204S	probably damaging	Het
Trim12a	C	T	7: 104,304,128	E259K	probably benign	Het
Tubgcp6	G	A	15: 89,102,029	R1436C	probably benign	Het
Tyrp1	C	T	4: 80,840,627	L246F	probably damaging	Het
Ubr4	G	T	4: 139,418,406	V216F		Het
Unc5a	A	G	13: 54,999,506	I409V	possibly damaging	Het
Vmn1r15	T	C	6: 57,258,414	L89P	probably damaging	Het
Vmn1r32	A	T	6: 66,553,321	L157*	probably null	Het
Zcchc24	A	G	14: 25,719,761	Y160H	probably damaging	Het
Zfp184	A	T	13: 21,960,206	H694L	probably damaging	Het
Zfp345	A	C	2: 150,472,803	Y271*	probably null	Het
Zranb3	T	C	1: 128,102,934		probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AAGAACTCACGATGTGCGG -3'
(R):5'- TCTGAAGGACAAAGTACCACG -3'

Sequencing Primer
(F):5'- GTGATGTCTGAGTAAGTCTTCTAACC -3'
(R):5'- CCACGTCATATTTAAACATTGCACG -3'

Posted On

2020-09-15