Incidental Mutation 'R7981:Pik3c2b'
ID 651192
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 046022-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R7981 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 133003547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,784,360 (GRCm39) F278I probably damaging Het
Abca8a T C 11: 109,980,739 (GRCm39) T100A probably benign Het
Adam34l A G 8: 44,078,850 (GRCm39) F458S probably damaging Het
Agbl1 A G 7: 76,094,588 (GRCm39) T740A unknown Het
Aldh1a2 A T 9: 71,171,102 (GRCm39) I197F probably damaging Het
Ankrd28 T C 14: 31,424,114 (GRCm39) T1009A probably benign Het
Antxrl T C 14: 33,787,838 (GRCm39) V287A probably damaging Het
Baiap2l1 G A 5: 144,294,700 (GRCm39) probably benign Het
Catsperd T C 17: 56,938,562 (GRCm39) V30A possibly damaging Het
Ccdc150 A T 1: 54,407,551 (GRCm39) K1109M probably damaging Het
Ccdc28a A G 10: 18,094,127 (GRCm39) L164P probably benign Het
Cnot1 C T 8: 96,489,797 (GRCm39) V469M probably damaging Het
Col16a1 T G 4: 129,980,347 (GRCm39) probably null Het
Coq9 A G 8: 95,569,285 (GRCm39) H39R probably benign Het
Crh T A 3: 19,748,216 (GRCm39) E142V probably benign Het
Depdc1a A G 3: 159,226,488 (GRCm39) N265S probably benign Het
Dlg5 T C 14: 24,208,213 (GRCm39) T998A probably benign Het
Epg5 T C 18: 78,052,929 (GRCm39) probably null Het
Gcc1 G A 6: 28,419,140 (GRCm39) L398F probably benign Het
Gde1 T C 7: 118,288,264 (GRCm39) T320A probably damaging Het
Gemin5 T C 11: 58,036,231 (GRCm39) D704G probably damaging Het
Gfi1 G A 5: 107,873,543 (GRCm39) probably benign Het
Insc A G 7: 114,428,302 (GRCm39) T92A probably damaging Het
Krtap6-2 T C 16: 89,216,562 (GRCm39) Y135C unknown Het
Lpcat2 T C 8: 93,582,182 (GRCm39) S34P probably damaging Het
Mansc1 T C 6: 134,587,274 (GRCm39) D301G possibly damaging Het
Mbl2 C A 19: 30,216,737 (GRCm39) T183K probably damaging Het
Mri1 A C 8: 84,983,792 (GRCm39) V33G possibly damaging Het
Mrps7 T C 11: 115,497,687 (GRCm39) M184T possibly damaging Het
Mug1 A T 6: 121,858,723 (GRCm39) Y1147F probably damaging Het
N4bp2 C T 5: 65,969,485 (GRCm39) H1416Y probably benign Het
Naa15 T C 3: 51,366,092 (GRCm39) F487S probably damaging Het
Nin C T 12: 70,089,591 (GRCm39) V1275I Het
Or4c116 A G 2: 88,942,400 (GRCm39) F152S probably damaging Het
Or55b3 A T 7: 102,127,036 (GRCm39) Y14N probably damaging Het
Pkn1 G T 8: 84,407,637 (GRCm39) N463K probably damaging Het
Pramel24 T G 4: 143,453,452 (GRCm39) F187V probably benign Het
Rab11fip3 C T 17: 26,216,963 (GRCm39) S816N probably damaging Het
Rassf4 G T 6: 116,617,218 (GRCm39) D262E probably damaging Het
Sec16a A G 2: 26,311,384 (GRCm39) probably null Het
Sspo A G 6: 48,445,428 (GRCm39) T2290A probably benign Het
Sumf1 A G 6: 108,129,186 (GRCm39) probably null Het
Syne1 T C 10: 5,179,248 (GRCm39) K4409E probably benign Het
Tasor T C 14: 27,168,373 (GRCm39) V305A possibly damaging Het
Tmco4 T G 4: 138,785,772 (GRCm39) L614R probably damaging Het
Tmem67 G T 4: 12,070,592 (GRCm39) N245K probably damaging Het
Trim58 T C 11: 58,542,138 (GRCm39) V366A probably benign Het
Vmn1r123 T C 7: 20,896,914 (GRCm39) S269P probably damaging Het
Vmn2r91 T A 17: 18,327,887 (GRCm39) S494T probably benign Het
Zbtb26 T A 2: 37,326,887 (GRCm39) I50L possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCATGAGGAAAGGACCC -3'
(R):5'- AGCACCTTCTCACACACTTG -3'

Sequencing Primer
(F):5'- AAGGACCCCTTTTCCATCTTCATGG -3'
(R):5'- CCCCACAGCCAGATGTTTG -3'
Posted On 2020-09-15