Incidental Mutation 'R7981:Olfr1221'
ID651195
Institutional Source Beutler Lab
Gene Symbol Olfr1221
Ensembl Gene ENSMUSG00000075102
Gene Nameolfactory receptor 1221
SynonymsGA_x6K02T2Q125-50591144-50590209, MOR233-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7981 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89109086-89117283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89112056 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 152 (F152S)
Ref Sequence ENSEMBL: ENSMUSP00000150194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099795] [ENSMUST00000143255] [ENSMUST00000213404] [ENSMUST00000217635]
Predicted Effect probably damaging
Transcript: ENSMUST00000099795
AA Change: F152S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102
AA Change: F152S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143255
AA Change: F152S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213404
AA Change: F152S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217635
AA Change: F152S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,089,913 T100A probably benign Het
Agbl1 A G 7: 76,444,840 T740A unknown Het
Aldh1a2 A T 9: 71,263,820 I197F probably damaging Het
Ankrd28 T C 14: 31,702,157 T1009A probably benign Het
Antxrl T C 14: 34,065,881 V287A probably damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
Catsperd T C 17: 56,631,562 V30A possibly damaging Het
Ccdc150 A T 1: 54,368,392 K1109M probably damaging Het
Ccdc28a A G 10: 18,218,379 L164P probably benign Het
Cnot1 C T 8: 95,763,169 V469M probably damaging Het
Col16a1 T G 4: 130,086,554 probably null Het
Coq9 A G 8: 94,842,657 H39R probably benign Het
Crh T A 3: 19,694,052 E142V probably benign Het
Depdc1a A G 3: 159,520,851 N265S probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Epg5 T C 18: 78,009,714 probably null Het
Fam208a T C 14: 27,446,416 V305A possibly damaging Het
Gcc1 G A 6: 28,419,141 L398F probably benign Het
Gde1 T C 7: 118,689,041 T320A probably damaging Het
Gemin5 T C 11: 58,145,405 D704G probably damaging Het
Gfi1 G A 5: 107,725,677 probably benign Het
Gm13078 T G 4: 143,726,882 F187V probably benign Het
Gm5346 A G 8: 43,625,813 F458S probably damaging Het
Gm8298 T A 3: 59,876,939 F278I probably damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Krtap6-2 T C 16: 89,419,674 Y135C unknown Het
Lpcat2 T C 8: 92,855,554 S34P probably damaging Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
Mbl2 C A 19: 30,239,337 T183K probably damaging Het
Mri1 A C 8: 84,257,163 V33G possibly damaging Het
Mrps7 T C 11: 115,606,861 M184T possibly damaging Het
Mug1 A T 6: 121,881,764 Y1147F probably damaging Het
N4bp2 C T 5: 65,812,142 H1416Y probably benign Het
Naa15 T C 3: 51,458,671 F487S probably damaging Het
Nin C T 12: 70,042,817 V1275I Het
Olfr543 A T 7: 102,477,829 Y14N probably damaging Het
Pik3c2b A T 1: 133,075,809 probably null Het
Pkn1 G T 8: 83,681,008 N463K probably damaging Het
Rab11fip3 C T 17: 25,997,989 S816N probably damaging Het
Rassf4 G T 6: 116,640,257 D262E probably damaging Het
Sec16a A G 2: 26,421,372 probably null Het
Sspo A G 6: 48,468,494 T2290A probably benign Het
Sumf1 A G 6: 108,152,225 probably null Het
Syne1 T C 10: 5,229,248 K4409E probably benign Het
Tmco4 T G 4: 139,058,461 L614R probably damaging Het
Tmem67 G T 4: 12,070,592 N245K probably damaging Het
Trim58 T C 11: 58,651,312 V366A probably benign Het
Vmn1r123 T C 7: 21,162,989 S269P probably damaging Het
Vmn2r91 T A 17: 18,107,625 S494T probably benign Het
Zbtb26 T A 2: 37,436,875 I50L possibly damaging Het
Other mutations in Olfr1221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Olfr1221 APN 2 89111679 missense probably benign 0.19
IGL01965:Olfr1221 APN 2 89112191 missense probably benign 0.37
IGL02645:Olfr1221 APN 2 89111619 missense probably benign 0.00
PIT4354001:Olfr1221 UTSW 2 89112486 nonsense probably null
R0124:Olfr1221 UTSW 2 89111744 missense possibly damaging 0.56
R0940:Olfr1221 UTSW 2 89112075 missense probably benign
R3689:Olfr1221 UTSW 2 89112042 missense possibly damaging 0.85
R4489:Olfr1221 UTSW 2 89111572 splice site probably null
R4706:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R4707:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R5133:Olfr1221 UTSW 2 89111796 splice site probably null
R6629:Olfr1221 UTSW 2 89112162 missense probably benign 0.09
R6644:Olfr1221 UTSW 2 89111981 missense probably benign 0.00
R6723:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6725:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6754:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6765:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6766:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R7215:Olfr1221 UTSW 2 89112501 nonsense probably null
R7562:Olfr1221 UTSW 2 89112285 missense probably benign 0.00
R7681:Olfr1221 UTSW 2 89111591 missense probably benign 0.00
R8318:Olfr1221 UTSW 2 89111898 missense probably benign 0.02
R8425:Olfr1221 UTSW 2 89112393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAACTGTGGGCTCTCAAAG -3'
(R):5'- GCATGACCCAATTGTTTGCC -3'

Sequencing Primer
(F):5'- ACAAGATGACACCATAGGAGAC -3'
(R):5'- CATACACTTCTTTACTGCGGTAGAGG -3'
Posted On2020-09-15