Incidental Mutation 'R7981:Vmn1r123'
ID651213
Institutional Source Beutler Lab
Gene Symbol Vmn1r123
Ensembl Gene ENSMUSG00000094385
Gene Namevomeronasal 1 receptor 123
SynonymsGm1446, LOC384695
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7981 (G1)
Quality Score194.009
Status Not validated
Chromosome7
Chromosomal Location21162185-21163108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21162989 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 269 (S269P)
Ref Sequence ENSEMBL: ENSMUSP00000125823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166948]
Predicted Effect probably damaging
Transcript: ENSMUST00000166948
AA Change: S269P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125823
Gene: ENSMUSG00000094385
AA Change: S269P

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 7e-18 PFAM
Pfam:7tm_1 31 291 2.1e-8 PFAM
Pfam:V1R 41 298 1.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,089,913 T100A probably benign Het
Agbl1 A G 7: 76,444,840 T740A unknown Het
Aldh1a2 A T 9: 71,263,820 I197F probably damaging Het
Ankrd28 T C 14: 31,702,157 T1009A probably benign Het
Antxrl T C 14: 34,065,881 V287A probably damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
Catsperd T C 17: 56,631,562 V30A possibly damaging Het
Ccdc150 A T 1: 54,368,392 K1109M probably damaging Het
Ccdc28a A G 10: 18,218,379 L164P probably benign Het
Cnot1 C T 8: 95,763,169 V469M probably damaging Het
Col16a1 T G 4: 130,086,554 probably null Het
Coq9 A G 8: 94,842,657 H39R probably benign Het
Crh T A 3: 19,694,052 E142V probably benign Het
Depdc1a A G 3: 159,520,851 N265S probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Epg5 T C 18: 78,009,714 probably null Het
Fam208a T C 14: 27,446,416 V305A possibly damaging Het
Gcc1 G A 6: 28,419,141 L398F probably benign Het
Gde1 T C 7: 118,689,041 T320A probably damaging Het
Gemin5 T C 11: 58,145,405 D704G probably damaging Het
Gfi1 G A 5: 107,725,677 probably benign Het
Gm13078 T G 4: 143,726,882 F187V probably benign Het
Gm5346 A G 8: 43,625,813 F458S probably damaging Het
Gm8298 T A 3: 59,876,939 F278I probably damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Krtap6-2 T C 16: 89,419,674 Y135C unknown Het
Lpcat2 T C 8: 92,855,554 S34P probably damaging Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
Mbl2 C A 19: 30,239,337 T183K probably damaging Het
Mri1 A C 8: 84,257,163 V33G possibly damaging Het
Mrps7 T C 11: 115,606,861 M184T possibly damaging Het
Mug1 A T 6: 121,881,764 Y1147F probably damaging Het
N4bp2 C T 5: 65,812,142 H1416Y probably benign Het
Naa15 T C 3: 51,458,671 F487S probably damaging Het
Nin C T 12: 70,042,817 V1275I Het
Olfr1221 A G 2: 89,112,056 F152S probably damaging Het
Olfr543 A T 7: 102,477,829 Y14N probably damaging Het
Pik3c2b A T 1: 133,075,809 probably null Het
Pkn1 G T 8: 83,681,008 N463K probably damaging Het
Rab11fip3 C T 17: 25,997,989 S816N probably damaging Het
Rassf4 G T 6: 116,640,257 D262E probably damaging Het
Sec16a A G 2: 26,421,372 probably null Het
Sspo A G 6: 48,468,494 T2290A probably benign Het
Sumf1 A G 6: 108,152,225 probably null Het
Syne1 T C 10: 5,229,248 K4409E probably benign Het
Tmco4 T G 4: 139,058,461 L614R probably damaging Het
Tmem67 G T 4: 12,070,592 N245K probably damaging Het
Trim58 T C 11: 58,651,312 V366A probably benign Het
Vmn2r91 T A 17: 18,107,625 S494T probably benign Het
Zbtb26 T A 2: 37,436,875 I50L possibly damaging Het
Other mutations in Vmn1r123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Vmn1r123 APN 7 21162291 missense possibly damaging 0.93
IGL02330:Vmn1r123 APN 7 21163044 missense probably damaging 0.99
IGL02742:Vmn1r123 APN 7 21163043 missense possibly damaging 0.93
IGL03240:Vmn1r123 APN 7 21162357 missense possibly damaging 0.94
R1173:Vmn1r123 UTSW 7 21162332 missense probably damaging 0.99
R6278:Vmn1r123 UTSW 7 21162849 missense possibly damaging 0.78
R6610:Vmn1r123 UTSW 7 21162590 missense probably benign 0.00
R6679:Vmn1r123 UTSW 7 21162943 nonsense probably null
R7241:Vmn1r123 UTSW 7 21162612 missense possibly damaging 0.95
R7642:Vmn1r123 UTSW 7 21162870 missense probably benign 0.11
R7702:Vmn1r123 UTSW 7 21162377 missense probably damaging 0.99
R7870:Vmn1r123 UTSW 7 21162267 missense probably damaging 1.00
R8554:Vmn1r123 UTSW 7 21163046 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCTCCATAGACATCGCCAG -3'
(R):5'- GCAGTGAGCACCATACTGTGTTC -3'

Sequencing Primer
(F):5'- GCGAATGCAGCACATCCTC -3'
(R):5'- GCACCATACTGTGTTCATACAAAATG -3'
Posted On2020-09-15