Incidental Mutation 'R7981:Insc'
ID651216
Institutional Source Beutler Lab
Gene Symbol Insc
Ensembl Gene ENSMUSG00000048782
Gene NameINSC spindle orientation adaptor protein
SynonymsInscuteable, 3830422K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7981 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114743694-114850383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114829067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000145636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117543] [ENSMUST00000169913] [ENSMUST00000206274]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104456
Predicted Effect probably benign
Transcript: ENSMUST00000117543
AA Change: T285A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782
AA Change: T285A

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150991
Predicted Effect probably benign
Transcript: ENSMUST00000169913
AA Change: T285A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782
AA Change: T285A

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000206274
AA Change: T92A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.2659 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to abnormal cochlear hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,089,913 T100A probably benign Het
Agbl1 A G 7: 76,444,840 T740A unknown Het
Aldh1a2 A T 9: 71,263,820 I197F probably damaging Het
Ankrd28 T C 14: 31,702,157 T1009A probably benign Het
Antxrl T C 14: 34,065,881 V287A probably damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
Catsperd T C 17: 56,631,562 V30A possibly damaging Het
Ccdc150 A T 1: 54,368,392 K1109M probably damaging Het
Ccdc28a A G 10: 18,218,379 L164P probably benign Het
Cnot1 C T 8: 95,763,169 V469M probably damaging Het
Col16a1 T G 4: 130,086,554 probably null Het
Coq9 A G 8: 94,842,657 H39R probably benign Het
Crh T A 3: 19,694,052 E142V probably benign Het
Depdc1a A G 3: 159,520,851 N265S probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Epg5 T C 18: 78,009,714 probably null Het
Fam208a T C 14: 27,446,416 V305A possibly damaging Het
Gcc1 G A 6: 28,419,141 L398F probably benign Het
Gde1 T C 7: 118,689,041 T320A probably damaging Het
Gemin5 T C 11: 58,145,405 D704G probably damaging Het
Gfi1 G A 5: 107,725,677 probably benign Het
Gm13078 T G 4: 143,726,882 F187V probably benign Het
Gm5346 A G 8: 43,625,813 F458S probably damaging Het
Gm8298 T A 3: 59,876,939 F278I probably damaging Het
Krtap6-2 T C 16: 89,419,674 Y135C unknown Het
Lpcat2 T C 8: 92,855,554 S34P probably damaging Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
Mbl2 C A 19: 30,239,337 T183K probably damaging Het
Mri1 A C 8: 84,257,163 V33G possibly damaging Het
Mrps7 T C 11: 115,606,861 M184T possibly damaging Het
Mug1 A T 6: 121,881,764 Y1147F probably damaging Het
N4bp2 C T 5: 65,812,142 H1416Y probably benign Het
Naa15 T C 3: 51,458,671 F487S probably damaging Het
Nin C T 12: 70,042,817 V1275I Het
Olfr1221 A G 2: 89,112,056 F152S probably damaging Het
Olfr543 A T 7: 102,477,829 Y14N probably damaging Het
Pik3c2b A T 1: 133,075,809 probably null Het
Pkn1 G T 8: 83,681,008 N463K probably damaging Het
Rab11fip3 C T 17: 25,997,989 S816N probably damaging Het
Rassf4 G T 6: 116,640,257 D262E probably damaging Het
Sec16a A G 2: 26,421,372 probably null Het
Sspo A G 6: 48,468,494 T2290A probably benign Het
Sumf1 A G 6: 108,152,225 probably null Het
Syne1 T C 10: 5,229,248 K4409E probably benign Het
Tmco4 T G 4: 139,058,461 L614R probably damaging Het
Tmem67 G T 4: 12,070,592 N245K probably damaging Het
Trim58 T C 11: 58,651,312 V366A probably benign Het
Vmn1r123 T C 7: 21,162,989 S269P probably damaging Het
Vmn2r91 T A 17: 18,107,625 S494T probably benign Het
Zbtb26 T A 2: 37,436,875 I50L possibly damaging Het
Other mutations in Insc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Insc APN 7 114842154 missense probably damaging 1.00
IGL02381:Insc APN 7 114849942 makesense probably null
IGL02515:Insc APN 7 114769008 missense probably damaging 1.00
IGL03154:Insc APN 7 114842189 missense probably null 1.00
Rare UTSW 7 114791148 missense probably damaging 1.00
R0139:Insc UTSW 7 114769002 missense probably damaging 0.98
R0322:Insc UTSW 7 114792265 missense probably damaging 0.99
R0708:Insc UTSW 7 114845146 missense probably damaging 0.98
R0715:Insc UTSW 7 114845077 missense probably benign 0.06
R1864:Insc UTSW 7 114842178 missense probably benign 0.06
R2069:Insc UTSW 7 114804593 critical splice donor site probably null
R3763:Insc UTSW 7 114790972 missense probably damaging 1.00
R4432:Insc UTSW 7 114769055 intron probably benign
R5331:Insc UTSW 7 114845038 missense probably damaging 0.97
R5346:Insc UTSW 7 114804541 missense possibly damaging 0.69
R5625:Insc UTSW 7 114829067 missense probably damaging 0.99
R5715:Insc UTSW 7 114849841 missense probably benign 0.04
R5860:Insc UTSW 7 114791148 missense probably damaging 1.00
R6199:Insc UTSW 7 114791166 splice site probably null
R7137:Insc UTSW 7 114811615 missense probably benign 0.21
R7440:Insc UTSW 7 114845043 missense possibly damaging 0.78
R7474:Insc UTSW 7 114768823 critical splice donor site probably null
R7504:Insc UTSW 7 114791298 critical splice donor site probably null
R7964:Insc UTSW 7 114846473 missense probably damaging 1.00
R7997:Insc UTSW 7 114845137 missense probably damaging 1.00
Z1176:Insc UTSW 7 114811639 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTTCCTGGGTTCAAAGCAG -3'
(R):5'- AGGCCCTATCACCTAGGTAAC -3'

Sequencing Primer
(F):5'- CAACTTTGGGTCATTTGGGAAG -3'
(R):5'- CCCTATCACCTAGGTAACCCACC -3'
Posted On2020-09-15