Mutagenetix > Incidental Mutations

Incidental Mutation 'R7981:Pkn1'

651219

Institutional Source

Beutler Lab

Gene Symbol

Pkn1

Ensembl Gene

ENSMUSG00000057672

Gene Name

protein kinase N1

Synonyms

PRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7981 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83666536-83699179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83681008 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 463 (N463K)

Ref Sequence

ENSEMBL: ENSMUSP00000116235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000132945] [ENSMUST00000144258]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005616
AA Change: N458K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: N458K

Domain	Start	End	E-Value	Type
low complexity region	15	30	N/A	INTRINSIC
Hr1	37	101	6.74e-20	SMART
Hr1	126	194	1.13e-21	SMART
Hr1	216	284	7.79e-25	SMART
C2	328	464	2.45e-1	SMART
low complexity region	569	601	N/A	INTRINSIC
S_TKc	619	878	2.83e-96	SMART
S_TK_X	879	943	5.29e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000132945
AA Change: N470K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672
AA Change: N470K

Domain	Start	End	E-Value	Type
low complexity region	27	42	N/A	INTRINSIC
Hr1	49	113	6.74e-20	SMART
Hr1	138	206	1.13e-21	SMART
Hr1	228	296	7.79e-25	SMART
C2	340	476	2.45e-1	SMART
low complexity region	581	613	N/A	INTRINSIC
Pfam:Pkinase	631	756	2.2e-23	PFAM
Pfam:Pkinase_Tyr	631	757	1.5e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144258
AA Change: N463K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: N463K

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
Hr1	42	106	6.74e-20	SMART
Hr1	131	199	1.13e-21	SMART
Hr1	221	289	7.79e-25	SMART
C2	333	469	2.45e-1	SMART
low complexity region	574	606	N/A	INTRINSIC
S_TKc	624	883	2.83e-96	SMART
S_TK_X	884	948	5.29e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,089,913	T100A	probably benign	Het
Agbl1	A	G	7: 76,444,840	T740A	unknown	Het
Aldh1a2	A	T	9: 71,263,820	I197F	probably damaging	Het
Ankrd28	T	C	14: 31,702,157	T1009A	probably benign	Het
Antxrl	T	C	14: 34,065,881	V287A	probably damaging	Het
Baiap2l1	G	A	5: 144,357,890		probably benign	Het
Catsperd	T	C	17: 56,631,562	V30A	possibly damaging	Het
Ccdc150	A	T	1: 54,368,392	K1109M	probably damaging	Het
Ccdc28a	A	G	10: 18,218,379	L164P	probably benign	Het
Cnot1	C	T	8: 95,763,169	V469M	probably damaging	Het
Col16a1	T	G	4: 130,086,554		probably null	Het
Coq9	A	G	8: 94,842,657	H39R	probably benign	Het
Crh	T	A	3: 19,694,052	E142V	probably benign	Het
Depdc1a	A	G	3: 159,520,851	N265S	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Epg5	T	C	18: 78,009,714		probably null	Het
Fam208a	T	C	14: 27,446,416	V305A	possibly damaging	Het
Gcc1	G	A	6: 28,419,141	L398F	probably benign	Het
Gde1	T	C	7: 118,689,041	T320A	probably damaging	Het
Gemin5	T	C	11: 58,145,405	D704G	probably damaging	Het
Gfi1	G	A	5: 107,725,677		probably benign	Het
Gm13078	T	G	4: 143,726,882	F187V	probably benign	Het
Gm5346	A	G	8: 43,625,813	F458S	probably damaging	Het
Gm8298	T	A	3: 59,876,939	F278I	probably damaging	Het
Insc	A	G	7: 114,829,067	T92A	probably damaging	Het
Krtap6-2	T	C	16: 89,419,674	Y135C	unknown	Het
Lpcat2	T	C	8: 92,855,554	S34P	probably damaging	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
Mbl2	C	A	19: 30,239,337	T183K	probably damaging	Het
Mri1	A	C	8: 84,257,163	V33G	possibly damaging	Het
Mrps7	T	C	11: 115,606,861	M184T	possibly damaging	Het
Mug1	A	T	6: 121,881,764	Y1147F	probably damaging	Het
N4bp2	C	T	5: 65,812,142	H1416Y	probably benign	Het
Naa15	T	C	3: 51,458,671	F487S	probably damaging	Het
Nin	C	T	12: 70,042,817	V1275I		Het
Olfr1221	A	G	2: 89,112,056	F152S	probably damaging	Het
Olfr543	A	T	7: 102,477,829	Y14N	probably damaging	Het
Pik3c2b	A	T	1: 133,075,809		probably null	Het
Rab11fip3	C	T	17: 25,997,989	S816N	probably damaging	Het
Rassf4	G	T	6: 116,640,257	D262E	probably damaging	Het
Sec16a	A	G	2: 26,421,372		probably null	Het
Sspo	A	G	6: 48,468,494	T2290A	probably benign	Het
Sumf1	A	G	6: 108,152,225		probably null	Het
Syne1	T	C	10: 5,229,248	K4409E	probably benign	Het
Tmco4	T	G	4: 139,058,461	L614R	probably damaging	Het
Tmem67	G	T	4: 12,070,592	N245K	probably damaging	Het
Trim58	T	C	11: 58,651,312	V366A	probably benign	Het
Vmn1r123	T	C	7: 21,162,989	S269P	probably damaging	Het
Vmn2r91	T	A	17: 18,107,625	S494T	probably benign	Het
Zbtb26	T	A	2: 37,436,875	I50L	possibly damaging	Het

Other mutations in Pkn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Pkn1	APN	8	83681006	missense	probably damaging	0.96
IGL02058:Pkn1	APN	8	83681225	nonsense	probably null
IGL03142:Pkn1	APN	8	83671023	missense	possibly damaging	0.85
Xinjiang	UTSW	8	83692927	nonsense	probably null
R0115:Pkn1	UTSW	8	83671029	missense	probably damaging	0.99
R0157:Pkn1	UTSW	8	83692820	missense	probably damaging	1.00
R0304:Pkn1	UTSW	8	83683607	splice site	probably benign
R0450:Pkn1	UTSW	8	83672324	missense	probably damaging	1.00
R0469:Pkn1	UTSW	8	83672324	missense	probably damaging	1.00
R1419:Pkn1	UTSW	8	83673522	missense	probably damaging	0.99
R1539:Pkn1	UTSW	8	83670337	missense	possibly damaging	0.49
R2025:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2026:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2027:Pkn1	UTSW	8	83671378	missense	probably damaging	1.00
R2029:Pkn1	UTSW	8	83677963	missense	possibly damaging	0.92
R2886:Pkn1	UTSW	8	83681238	missense	probably benign	0.28
R3017:Pkn1	UTSW	8	83670170	missense	probably benign	0.13
R3402:Pkn1	UTSW	8	83670230	missense	probably damaging	1.00
R4110:Pkn1	UTSW	8	83691199	missense	probably benign	0.41
R4504:Pkn1	UTSW	8	83692927	nonsense	probably null
R4739:Pkn1	UTSW	8	83671749	missense	probably damaging	0.98
R4838:Pkn1	UTSW	8	83677966	missense	probably damaging	1.00
R4857:Pkn1	UTSW	8	83684227	splice site	probably null
R5239:Pkn1	UTSW	8	83684182	missense	probably damaging	1.00
R5558:Pkn1	UTSW	8	83684722	missense	probably damaging	1.00
R5613:Pkn1	UTSW	8	83677761	missense	probably benign	0.00
R6169:Pkn1	UTSW	8	83681206	nonsense	probably null
R6172:Pkn1	UTSW	8	83670755	missense	possibly damaging	0.48
R6273:Pkn1	UTSW	8	83672270	missense	probably damaging	0.96
R6318:Pkn1	UTSW	8	83683591	missense	probably damaging	1.00
R6531:Pkn1	UTSW	8	83670293	missense	probably benign	0.09
R6969:Pkn1	UTSW	8	83683426	missense	probably damaging	1.00
R7142:Pkn1	UTSW	8	83693967	missense	possibly damaging	0.50
R7157:Pkn1	UTSW	8	83671734	missense	probably damaging	1.00
R7189:Pkn1	UTSW	8	83692673	missense	possibly damaging	0.74
Z1176:Pkn1	UTSW	8	83673497	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCTTCTGGGAACACGATC -3'
(R):5'- TTTACCCTGGAGCTGGAGAG -3'

Sequencing Primer
(F):5'- GATTCGCCTGGCACCAATC -3'
(R):5'- CTGGAGAGGGTGAGCCGTG -3'

Posted On

2020-09-15