Mutagenetix > Incidental Mutations

Incidental Mutation 'R7981:Rab11fip3'

651238

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip3

Ensembl Gene

ENSMUSG00000037098

Gene Name

RAB11 family interacting protein 3 (class II)

Synonyms

D030060O14Rik, Rab11-FIP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7981 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25989036-26069409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25997989 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 816 (S816N)

Ref Sequence

ENSEMBL: ENSMUSP00000113521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103]

Predicted Effect

probably damaging
Transcript: ENSMUST00000118828
AA Change: S168N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: S168N

Domain	Start	End	E-Value	Type
low complexity region	136	148	N/A	INTRINSIC
low complexity region	313	333	N/A	INTRINSIC
Blast:BRLZ	335	385	2e-11	BLAST
Pfam:RBD-FIP	404	444	2.8e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120691
AA Change: S771N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: S771N

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	3.12e-31	PROSPERO
internal_repeat_1	144	294	3.12e-31	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	739	751	N/A	INTRINSIC
low complexity region	916	936	N/A	INTRINSIC
Blast:BRLZ	938	988	2e-11	BLAST
Pfam:RBD-FIP	1007	1047	4.7e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122103
AA Change: S816N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: S816N

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	2.03e-32	PROSPERO
internal_repeat_1	144	294	2.03e-32	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	784	796	N/A	INTRINSIC
low complexity region	961	981	N/A	INTRINSIC
Blast:BRLZ	983	1033	2e-11	BLAST
Pfam:RBD-FIP	1052	1092	4.9e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,089,913	T100A	probably benign	Het
Agbl1	A	G	7: 76,444,840	T740A	unknown	Het
Aldh1a2	A	T	9: 71,263,820	I197F	probably damaging	Het
Ankrd28	T	C	14: 31,702,157	T1009A	probably benign	Het
Antxrl	T	C	14: 34,065,881	V287A	probably damaging	Het
Baiap2l1	G	A	5: 144,357,890		probably benign	Het
Catsperd	T	C	17: 56,631,562	V30A	possibly damaging	Het
Ccdc150	A	T	1: 54,368,392	K1109M	probably damaging	Het
Ccdc28a	A	G	10: 18,218,379	L164P	probably benign	Het
Cnot1	C	T	8: 95,763,169	V469M	probably damaging	Het
Col16a1	T	G	4: 130,086,554		probably null	Het
Coq9	A	G	8: 94,842,657	H39R	probably benign	Het
Crh	T	A	3: 19,694,052	E142V	probably benign	Het
Depdc1a	A	G	3: 159,520,851	N265S	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Epg5	T	C	18: 78,009,714		probably null	Het
Fam208a	T	C	14: 27,446,416	V305A	possibly damaging	Het
Gcc1	G	A	6: 28,419,141	L398F	probably benign	Het
Gde1	T	C	7: 118,689,041	T320A	probably damaging	Het
Gemin5	T	C	11: 58,145,405	D704G	probably damaging	Het
Gfi1	G	A	5: 107,725,677		probably benign	Het
Gm13078	T	G	4: 143,726,882	F187V	probably benign	Het
Gm5346	A	G	8: 43,625,813	F458S	probably damaging	Het
Gm8298	T	A	3: 59,876,939	F278I	probably damaging	Het
Insc	A	G	7: 114,829,067	T92A	probably damaging	Het
Krtap6-2	T	C	16: 89,419,674	Y135C	unknown	Het
Lpcat2	T	C	8: 92,855,554	S34P	probably damaging	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
Mbl2	C	A	19: 30,239,337	T183K	probably damaging	Het
Mri1	A	C	8: 84,257,163	V33G	possibly damaging	Het
Mrps7	T	C	11: 115,606,861	M184T	possibly damaging	Het
Mug1	A	T	6: 121,881,764	Y1147F	probably damaging	Het
N4bp2	C	T	5: 65,812,142	H1416Y	probably benign	Het
Naa15	T	C	3: 51,458,671	F487S	probably damaging	Het
Nin	C	T	12: 70,042,817	V1275I		Het
Olfr1221	A	G	2: 89,112,056	F152S	probably damaging	Het
Olfr543	A	T	7: 102,477,829	Y14N	probably damaging	Het
Pik3c2b	A	T	1: 133,075,809		probably null	Het
Pkn1	G	T	8: 83,681,008	N463K	probably damaging	Het
Rassf4	G	T	6: 116,640,257	D262E	probably damaging	Het
Sec16a	A	G	2: 26,421,372		probably null	Het
Sspo	A	G	6: 48,468,494	T2290A	probably benign	Het
Sumf1	A	G	6: 108,152,225		probably null	Het
Syne1	T	C	10: 5,229,248	K4409E	probably benign	Het
Tmco4	T	G	4: 139,058,461	L614R	probably damaging	Het
Tmem67	G	T	4: 12,070,592	N245K	probably damaging	Het
Trim58	T	C	11: 58,651,312	V366A	probably benign	Het
Vmn1r123	T	C	7: 21,162,989	S269P	probably damaging	Het
Vmn2r91	T	A	17: 18,107,625	S494T	probably benign	Het
Zbtb26	T	A	2: 37,436,875	I50L	possibly damaging	Het

Other mutations in Rab11fip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rab11fip3	APN	17	25991809	splice site	probably benign
IGL00420:Rab11fip3	APN	17	26067625	missense	probably benign	0.20
IGL01291:Rab11fip3	APN	17	26016113	missense	probably damaging	0.99
IGL01473:Rab11fip3	APN	17	26068735	missense	possibly damaging	0.53
IGL01687:Rab11fip3	APN	17	26067982	missense	probably damaging	0.97
IGL01764:Rab11fip3	APN	17	26068693	missense	probably benign	0.02
IGL01977:Rab11fip3	APN	17	26068003	missense	possibly damaging	0.72
IGL02140:Rab11fip3	APN	17	26067892	missense	probably benign	0.33
IGL02434:Rab11fip3	APN	17	26068835	missense	possibly damaging	0.85
IGL02549:Rab11fip3	APN	17	25994320	missense	probably damaging	0.96
IGL02889:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
IGL02953:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
ANU05:Rab11fip3	UTSW	17	26016113	missense	probably damaging	0.99
R0193:Rab11fip3	UTSW	17	25990999	missense	probably damaging	0.99
R0388:Rab11fip3	UTSW	17	26069072	missense	probably benign	0.33
R0543:Rab11fip3	UTSW	17	25994225	missense	probably damaging	1.00
R0678:Rab11fip3	UTSW	17	26068847	missense	probably benign	0.00
R1283:Rab11fip3	UTSW	17	26004554	missense	probably damaging	1.00
R1473:Rab11fip3	UTSW	17	25991322	missense	probably damaging	1.00
R1625:Rab11fip3	UTSW	17	26068891	missense	possibly damaging	0.72
R1973:Rab11fip3	UTSW	17	26024391	missense	probably damaging	0.97
R2160:Rab11fip3	UTSW	17	26069054	missense	probably benign	0.33
R2197:Rab11fip3	UTSW	17	26068178	missense	probably benign
R2382:Rab11fip3	UTSW	17	25990867	nonsense	probably null
R3028:Rab11fip3	UTSW	17	26015942	critical splice donor site	probably null
R3797:Rab11fip3	UTSW	17	26068526	missense	possibly damaging	0.73
R4012:Rab11fip3	UTSW	17	26068028	frame shift	probably null
R4064:Rab11fip3	UTSW	17	26024394	missense	probably damaging	0.97
R4478:Rab11fip3	UTSW	17	26016083	missense	probably damaging	1.00
R4527:Rab11fip3	UTSW	17	26036657	missense	probably damaging	1.00
R4565:Rab11fip3	UTSW	17	26068706	missense	possibly damaging	0.73
R5048:Rab11fip3	UTSW	17	26067580	critical splice donor site	probably null
R5138:Rab11fip3	UTSW	17	25991026	missense	probably benign	0.32
R5317:Rab11fip3	UTSW	17	26068078	missense	possibly damaging	0.72
R5453:Rab11fip3	UTSW	17	25992581	critical splice donor site	probably null
R5495:Rab11fip3	UTSW	17	26016143	missense	probably damaging	0.99
R5525:Rab11fip3	UTSW	17	25991295	missense	probably damaging	1.00
R5654:Rab11fip3	UTSW	17	26016064	missense	probably damaging	1.00
R5716:Rab11fip3	UTSW	17	26036664	missense	probably damaging	1.00
R5818:Rab11fip3	UTSW	17	26016116	missense	probably damaging	1.00
R6044:Rab11fip3	UTSW	17	26067869	missense	possibly damaging	0.93
R6716:Rab11fip3	UTSW	17	25991057	missense	probably damaging	1.00
R6785:Rab11fip3	UTSW	17	25991718	missense	probably damaging	0.99
R7161:Rab11fip3	UTSW	17	26069090	missense	probably benign	0.09
R7390:Rab11fip3	UTSW	17	26068152	missense	possibly damaging	0.81
R7447:Rab11fip3	UTSW	17	26068874	missense	possibly damaging	0.66
R7836:Rab11fip3	UTSW	17	26068258	missense	possibly damaging	0.82
R8008:Rab11fip3	UTSW	17	26067982	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGTTATAGTCCTCTGGCCATGC -3'
(R):5'- ATGATAGCTGCGTGGCTCTG -3'

Sequencing Primer
(F):5'- GTTTTCTGCAGGACTCTG -3'
(R):5'- GGCTCTGGATTTATGAAATAGTCTC -3'

Posted On

2020-09-15