Incidental Mutation 'R7981:Catsperd'
ID651239
Institutional Source Beutler Lab
Gene Symbol Catsperd
Ensembl Gene ENSMUSG00000040828
Gene Namecation channel sperm associated auxiliary subunit delta
Synonyms4933402B14Rik, 4921529N20Rik, Gm6095, Tmem146
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7981 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56628143-56664456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56631562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000108603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000112979]
Predicted Effect probably benign
Transcript: ENSMUST00000047226
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112979
AA Change: V30A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828
AA Change: V30A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion in this gene display male infertility. Hyperactivity of sperm fails to develop under capacitating conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,089,913 T100A probably benign Het
Agbl1 A G 7: 76,444,840 T740A unknown Het
Aldh1a2 A T 9: 71,263,820 I197F probably damaging Het
Ankrd28 T C 14: 31,702,157 T1009A probably benign Het
Antxrl T C 14: 34,065,881 V287A probably damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
Ccdc150 A T 1: 54,368,392 K1109M probably damaging Het
Ccdc28a A G 10: 18,218,379 L164P probably benign Het
Cnot1 C T 8: 95,763,169 V469M probably damaging Het
Col16a1 T G 4: 130,086,554 probably null Het
Coq9 A G 8: 94,842,657 H39R probably benign Het
Crh T A 3: 19,694,052 E142V probably benign Het
Depdc1a A G 3: 159,520,851 N265S probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Epg5 T C 18: 78,009,714 probably null Het
Fam208a T C 14: 27,446,416 V305A possibly damaging Het
Gcc1 G A 6: 28,419,141 L398F probably benign Het
Gde1 T C 7: 118,689,041 T320A probably damaging Het
Gemin5 T C 11: 58,145,405 D704G probably damaging Het
Gfi1 G A 5: 107,725,677 probably benign Het
Gm13078 T G 4: 143,726,882 F187V probably benign Het
Gm5346 A G 8: 43,625,813 F458S probably damaging Het
Gm8298 T A 3: 59,876,939 F278I probably damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Krtap6-2 T C 16: 89,419,674 Y135C unknown Het
Lpcat2 T C 8: 92,855,554 S34P probably damaging Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
Mbl2 C A 19: 30,239,337 T183K probably damaging Het
Mri1 A C 8: 84,257,163 V33G possibly damaging Het
Mrps7 T C 11: 115,606,861 M184T possibly damaging Het
Mug1 A T 6: 121,881,764 Y1147F probably damaging Het
N4bp2 C T 5: 65,812,142 H1416Y probably benign Het
Naa15 T C 3: 51,458,671 F487S probably damaging Het
Nin C T 12: 70,042,817 V1275I Het
Olfr1221 A G 2: 89,112,056 F152S probably damaging Het
Olfr543 A T 7: 102,477,829 Y14N probably damaging Het
Pik3c2b A T 1: 133,075,809 probably null Het
Pkn1 G T 8: 83,681,008 N463K probably damaging Het
Rab11fip3 C T 17: 25,997,989 S816N probably damaging Het
Rassf4 G T 6: 116,640,257 D262E probably damaging Het
Sec16a A G 2: 26,421,372 probably null Het
Sspo A G 6: 48,468,494 T2290A probably benign Het
Sumf1 A G 6: 108,152,225 probably null Het
Syne1 T C 10: 5,229,248 K4409E probably benign Het
Tmco4 T G 4: 139,058,461 L614R probably damaging Het
Tmem67 G T 4: 12,070,592 N245K probably damaging Het
Trim58 T C 11: 58,651,312 V366A probably benign Het
Vmn1r123 T C 7: 21,162,989 S269P probably damaging Het
Vmn2r91 T A 17: 18,107,625 S494T probably benign Het
Zbtb26 T A 2: 37,436,875 I50L possibly damaging Het
Other mutations in Catsperd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Catsperd APN 17 56661271 missense probably damaging 0.98
IGL02598:Catsperd APN 17 56647815 splice site probably null
IGL03037:Catsperd APN 17 56641583 missense possibly damaging 0.80
IGL03330:Catsperd APN 17 56632316 missense possibly damaging 0.45
R0391:Catsperd UTSW 17 56662821 missense probably benign 0.00
R0463:Catsperd UTSW 17 56659554 missense probably damaging 0.99
R0506:Catsperd UTSW 17 56658078 missense possibly damaging 0.95
R0538:Catsperd UTSW 17 56662828 missense probably benign 0.00
R0550:Catsperd UTSW 17 56663427 critical splice donor site probably null
R1503:Catsperd UTSW 17 56654525 missense possibly damaging 0.63
R1705:Catsperd UTSW 17 56633521 missense probably damaging 0.97
R1919:Catsperd UTSW 17 56635548 missense probably damaging 0.99
R2851:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R2852:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R3147:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R3148:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R4084:Catsperd UTSW 17 56654453 missense probably benign 0.14
R4329:Catsperd UTSW 17 56654517 missense possibly damaging 0.80
R4940:Catsperd UTSW 17 56662736 missense possibly damaging 0.95
R4944:Catsperd UTSW 17 56662744 missense probably damaging 0.97
R4952:Catsperd UTSW 17 56632303 missense probably damaging 0.99
R5079:Catsperd UTSW 17 56658153 critical splice donor site probably null
R5259:Catsperd UTSW 17 56660235 missense possibly damaging 0.93
R5635:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R5929:Catsperd UTSW 17 56652493 missense probably benign 0.00
R6789:Catsperd UTSW 17 56654426 splice site probably null
R6909:Catsperd UTSW 17 56650781 missense probably damaging 0.96
R6920:Catsperd UTSW 17 56655175 nonsense probably null
R7099:Catsperd UTSW 17 56628811 splice site probably null
R7106:Catsperd UTSW 17 56658070 splice site probably null
R7371:Catsperd UTSW 17 56650801 missense probably benign 0.22
R7405:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R7478:Catsperd UTSW 17 56664055 missense probably benign 0.00
R7781:Catsperd UTSW 17 56664072 missense probably benign 0.00
R7918:Catsperd UTSW 17 56631564 missense probably benign 0.06
R8200:Catsperd UTSW 17 56632368 critical splice donor site probably null
R8487:Catsperd UTSW 17 56663419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGGAGAGACCATGATGAAT -3'
(R):5'- GAGCTCAGGGTGTCAGGG -3'

Sequencing Primer
(F):5'- CAGTGGTTAGATCACTAGCTGCC -3'
(R):5'- CATTTGCAAGTCAAGATGCCTGAG -3'
Posted On2020-09-15