Incidental Mutation 'R7982:Zcchc2'
ID651247
Institutional Source Beutler Lab
Gene Symbol Zcchc2
Ensembl Gene ENSMUSG00000038866
Gene Namezinc finger, CCHC domain containing 2
Synonyms9930114B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105990406-106034074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106031171 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1124 (C1124Y)
Ref Sequence ENSEMBL: ENSMUSP00000113128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118196] [ENSMUST00000119166]
Predicted Effect probably damaging
Transcript: ENSMUST00000118196
AA Change: C1124Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113974
Gene: ENSMUSG00000038866
AA Change: C1124Y

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119166
AA Change: C1124Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113128
Gene: ENSMUSG00000038866
AA Change: C1124Y

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000188954
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Zcchc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc2 APN 1 106030263 missense probably benign 0.25
IGL01339:Zcchc2 APN 1 106029775 missense probably damaging 1.00
IGL01981:Zcchc2 APN 1 106027499 missense probably damaging 1.00
IGL02172:Zcchc2 APN 1 106000934 missense probably benign 0.00
IGL02864:Zcchc2 APN 1 106016084 missense probably damaging 1.00
IGL02993:Zcchc2 APN 1 106030168 missense probably damaging 0.99
IGL03163:Zcchc2 APN 1 106031111 missense probably damaging 1.00
P0042:Zcchc2 UTSW 1 106030997 missense possibly damaging 0.95
R0200:Zcchc2 UTSW 1 106004123 missense probably damaging 1.00
R0477:Zcchc2 UTSW 1 106030270 missense possibly damaging 0.91
R0501:Zcchc2 UTSW 1 106016091 missense possibly damaging 0.88
R0689:Zcchc2 UTSW 1 106030504 nonsense probably null
R1799:Zcchc2 UTSW 1 106030287 missense probably benign 0.00
R2016:Zcchc2 UTSW 1 106004121 splice site probably null
R2153:Zcchc2 UTSW 1 106021723 splice site probably null
R2175:Zcchc2 UTSW 1 106027423 missense probably damaging 1.00
R2999:Zcchc2 UTSW 1 106030024 missense probably benign 0.00
R3113:Zcchc2 UTSW 1 105991022 missense unknown
R4571:Zcchc2 UTSW 1 106031257 missense possibly damaging 0.66
R4670:Zcchc2 UTSW 1 105990266 unclassified probably benign
R5067:Zcchc2 UTSW 1 106030964 missense probably damaging 1.00
R5423:Zcchc2 UTSW 1 106030700 missense probably damaging 1.00
R5499:Zcchc2 UTSW 1 106030592 missense possibly damaging 0.71
R5522:Zcchc2 UTSW 1 106023696 missense probably benign 0.00
R5526:Zcchc2 UTSW 1 106030254 nonsense probably null
R5571:Zcchc2 UTSW 1 106023672 missense probably benign
R5599:Zcchc2 UTSW 1 106032150 missense probably damaging 1.00
R6133:Zcchc2 UTSW 1 106019879 missense probably damaging 1.00
R6191:Zcchc2 UTSW 1 105990170 unclassified probably benign
R6194:Zcchc2 UTSW 1 105991117 missense probably damaging 1.00
R6246:Zcchc2 UTSW 1 106030066 missense possibly damaging 0.75
R7089:Zcchc2 UTSW 1 106030481 missense probably damaging 1.00
R7626:Zcchc2 UTSW 1 106001012 missense possibly damaging 0.69
R7749:Zcchc2 UTSW 1 106018273 missense probably damaging 1.00
R7781:Zcchc2 UTSW 1 106004165 missense probably damaging 1.00
R7792:Zcchc2 UTSW 1 106018252 missense probably damaging 0.99
R8316:Zcchc2 UTSW 1 106032114 missense probably damaging 1.00
R8351:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8451:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8697:Zcchc2 UTSW 1 106030764 missense probably damaging 0.98
R8862:Zcchc2 UTSW 1 106031268 makesense probably null
RF022:Zcchc2 UTSW 1 106011742 missense possibly damaging 0.85
Z1176:Zcchc2 UTSW 1 105991126 missense probably damaging 1.00
Z1177:Zcchc2 UTSW 1 106004136 missense possibly damaging 0.74
Z1177:Zcchc2 UTSW 1 106029825 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCCTCAGACTCCATATGC -3'
(R):5'- GTCTATGCTGGCCATCTCTG -3'

Sequencing Primer
(F):5'- CAAATGGACTGGTGCATGACCC -3'
(R):5'- GGCTGCATTTTGCTACTGAAAATAC -3'
Posted On2020-09-15