Incidental Mutation 'R7982:Fam214b'
ID651252
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43034483 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 371 (T371A)
Ref Sequence ENSEMBL: ENSMUSP00000038177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030] [ENSMUST00000144999] [ENSMUST00000152846]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036462
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107956
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107957
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107958
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107959
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135660
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
BB010:Fam214b UTSW 4 43035919 missense probably benign
BB020:Fam214b UTSW 4 43035919 missense probably benign
PIT4431001:Fam214b UTSW 4 43036024 missense probably damaging 0.99
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R1121:Fam214b UTSW 4 43034947 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R2853:Fam214b UTSW 4 43036293 missense probably benign
R3878:Fam214b UTSW 4 43035867 missense probably damaging 1.00
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R6556:Fam214b UTSW 4 43033896 missense probably damaging 0.96
R7107:Fam214b UTSW 4 43036434 missense probably benign 0.10
R7608:Fam214b UTSW 4 43036533 missense probably damaging 0.99
R7933:Fam214b UTSW 4 43035919 missense probably benign
R8017:Fam214b UTSW 4 43034413 missense probably damaging 1.00
R8328:Fam214b UTSW 4 43034751 missense probably benign
R8715:Fam214b UTSW 4 43033944 missense possibly damaging 0.80
R8792:Fam214b UTSW 4 43033546 missense probably damaging 0.99
R8837:Fam214b UTSW 4 43034531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTGGCTCTACCCTATACTAG -3'
(R):5'- GGGCAACTTTGAGGTAGCTC -3'

Sequencing Primer
(F):5'- TCTTAACCTGACTCACTCCTAGAAG -3'
(R):5'- GCTCCTTTTGGACTTTGTAATTAAGG -3'
Posted On2020-09-15