Mutagenetix > Incidental Mutation

Incidental Mutation 'R7982:Pds5b'

651260

Institutional Source

Beutler Lab

Gene Symbol

Pds5b

Ensembl Gene

ENSMUSG00000034021

Gene Name

PDS5 cohesin associated factor B

Synonyms

Aprin, AS3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7982 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150673739-150810690 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150769941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 706 (I706T)

Ref Sequence

ENSEMBL: ENSMUSP00000016569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000110486] [ENSMUST00000202170]

AlphaFold

Q4VA53

Predicted Effect

probably damaging
Transcript: ENSMUST00000016569
AA Change: I706T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: I706T

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1247	1259	4.14e1	SMART
AT_hook	1285	1297	1.35e2	SMART
low complexity region	1307	1316	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC
AT_hook	1370	1382	1.46e0	SMART
low complexity region	1437	1446	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038900
AA Change: I706T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: I706T

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1373	1385	1.46e0	SMART
low complexity region	1440	1449	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110486
AA Change: I177T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106112
Gene: ENSMUSG00000034021
AA Change: I177T

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	520	5e-10	SMART
low complexity region	627	638	N/A	INTRINSIC
low complexity region	690	698	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202170
AA Change: I706T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: I706T

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1372	1384	1.46e0	SMART
low complexity region	1439	1448	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb6	A	G	1: 75,173,640	S625P	probably damaging	Het
Actl6b	A	G	5: 137,563,162	N142S	probably benign	Het
Ank1	A	T	8: 23,119,381	D1363V	probably damaging	Het
Aox4	A	C	1: 58,257,241	L1032F	possibly damaging	Het
Bcl2l15	T	C	3: 103,832,842	M4T	probably damaging	Het
Cand1	A	T	10: 119,216,473	S242R	probably damaging	Het
Cant1	A	T	11: 118,410,142	V229D	probably benign	Het
Ccdc117	A	G	11: 5,531,460	S224P	possibly damaging	Het
Cdc42ep4	T	C	11: 113,728,576	R330G	possibly damaging	Het
Cep164	T	C	9: 45,778,864	E527G	probably benign	Het
Cfap58	A	G	19: 47,974,567	D472G	probably benign	Het
Cln6	A	C	9: 62,849,168	K198T	possibly damaging	Het
Col4a4	G	A	1: 82,571,441		probably benign	Het
Cyp1b1	T	C	17: 79,710,490	Y412C	probably damaging	Het
Dhx30	A	T	9: 110,085,456	L991Q	probably damaging	Het
Dst	C	T	1: 34,182,540	T2475I	possibly damaging	Het
Exoc8	A	T	8: 124,896,410	V406E	probably damaging	Het
Fam214b	T	C	4: 43,034,483	T371A	probably damaging	Het
Grk6	T	A	13: 55,451,706	C201S	probably damaging	Het
Helz	T	C	11: 107,626,630	V664A	possibly damaging	Het
Hsd17b11	A	G	5: 104,003,224	C215R	possibly damaging	Het
Hspb11	T	C	4: 107,275,283	V89A	probably benign	Het
Kbtbd12	T	C	6: 88,618,634	I71M	possibly damaging	Het
Khdc1a	A	T	1: 21,350,906	H105L	probably benign	Het
Klf6	T	A	13: 5,861,823	L62Q	probably damaging	Het
Mc1r	A	G	8: 123,408,140	R211G	probably damaging	Het
Nt5m	T	A	11: 59,848,331	W68R	possibly damaging	Het
Nufip1	T	C	14: 76,126,239	V301A	probably benign	Het
Olfr104-ps	T	G	17: 37,362,611	F165V	probably damaging	Het
Olfr1535	T	C	13: 21,555,966	N19D	probably benign	Het
Olfr209	A	G	16: 59,361,564	I218T	probably benign	Het
Olfr455	T	A	6: 42,538,291	T244S	probably damaging	Het
Olfr561	A	T	7: 102,775,103	D193V	probably damaging	Het
Ostn	T	C	16: 27,321,439		probably null	Het
Pcdhb6	C	T	18: 37,334,220	R65*	probably null	Het
Pgm1	T	G	5: 64,100,959	Y96D	probably damaging	Het
Pkd1l2	G	A	8: 117,051,187	T875I	possibly damaging	Het
Poc1b	A	G	10: 99,164,902	S355G	probably benign	Het
Ppp6r1	A	C	7: 4,643,158	D181E	probably benign	Het
Pstpip2	G	A	18: 77,879,373	V325M	probably benign	Het
Rras2	A	T	7: 114,058,951	V92D	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Ryr3	GTCTTCTTCTTCTTCTTC	GTCTTCTTCTTCTTC	2: 112,669,249		probably benign	Het
Stac2	T	A	11: 98,042,553	M188L	probably benign	Het
Synrg	G	A	11: 84,019,818	D859N	probably damaging	Het
Tarbp1	A	T	8: 126,444,301	S987T	probably damaging	Het
Tbx20	C	A	9: 24,773,924		probably benign	Het
Trim30d	G	T	7: 104,472,610	N309K	possibly damaging	Het
Ttc16	C	T	2: 32,775,035		probably benign	Het
Ttc34	T	A	4: 154,861,418	I303N	possibly damaging	Het
Ubr4	T	C	4: 139,428,208		probably null	Het
Uros	A	T	7: 133,692,549	S168T	unknown	Het
Vmn2r6	C	T	3: 64,559,820	G86D	probably damaging	Het
Ybx2	C	T	11: 69,940,622	T295I	possibly damaging	Het
Zbed5	T	A	5: 129,900,480	C146S	possibly damaging	Het
Zcchc2	G	A	1: 106,031,171	C1124Y	probably damaging	Het
Zfp626	G	A	7: 27,810,750		probably null	Het

Other mutations in Pds5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Pds5b	APN	5	150722542	missense	probably benign	0.25
IGL01530:Pds5b	APN	5	150792175	missense	probably benign	0.38
IGL01812:Pds5b	APN	5	150780689	missense	probably damaging	1.00
IGL02163:Pds5b	APN	5	150756406	missense	probably benign	0.00
IGL02730:Pds5b	APN	5	150780752	splice site	probably benign
IGL02825:Pds5b	APN	5	150728970	missense	possibly damaging	0.90
IGL03143:Pds5b	APN	5	150779257	missense	probably damaging	1.00
IGL03379:Pds5b	APN	5	150788331	missense	probably damaging	1.00
PIT4283001:Pds5b	UTSW	5	150778309	missense	probably damaging	0.99
R0026:Pds5b	UTSW	5	150749830	splice site	probably benign
R0197:Pds5b	UTSW	5	150754431	missense	probably benign	0.28
R0347:Pds5b	UTSW	5	150736427	splice site	probably benign
R0396:Pds5b	UTSW	5	150779275	missense	possibly damaging	0.96
R0400:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R0442:Pds5b	UTSW	5	150716544	splice site	probably benign
R0745:Pds5b	UTSW	5	150805671	missense	probably benign
R0839:Pds5b	UTSW	5	150764962	missense	probably benign	0.23
R0866:Pds5b	UTSW	5	150739191	splice site	probably benign
R1247:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R1330:Pds5b	UTSW	5	150761077	missense	probably damaging	0.97
R1440:Pds5b	UTSW	5	150754417	missense	probably damaging	1.00
R1526:Pds5b	UTSW	5	150716400	splice site	probably null
R2010:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R2051:Pds5b	UTSW	5	150748190	missense	probably damaging	1.00
R2507:Pds5b	UTSW	5	150756428	missense	possibly damaging	0.90
R3111:Pds5b	UTSW	5	150719907	missense	probably damaging	1.00
R3820:Pds5b	UTSW	5	150736337	missense	possibly damaging	0.94
R3911:Pds5b	UTSW	5	150746706	missense	probably benign	0.41
R4077:Pds5b	UTSW	5	150794359	missense	possibly damaging	0.62
R4118:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R4342:Pds5b	UTSW	5	150800854	missense	probably benign	0.17
R4416:Pds5b	UTSW	5	150736396	missense	probably damaging	1.00
R4503:Pds5b	UTSW	5	150728934	missense	probably damaging	1.00
R4524:Pds5b	UTSW	5	150788316	missense	probably damaging	1.00
R4579:Pds5b	UTSW	5	150746732	missense	probably damaging	0.98
R4623:Pds5b	UTSW	5	150800601	missense	probably benign	0.37
R4847:Pds5b	UTSW	5	150748112	missense	probably damaging	1.00
R4885:Pds5b	UTSW	5	150716462	missense	probably benign	0.21
R5271:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R5281:Pds5b	UTSW	5	150746608	missense	probably benign	0.26
R5337:Pds5b	UTSW	5	150793597	missense	probably benign	0.03
R5635:Pds5b	UTSW	5	150778221	missense	possibly damaging	0.78
R5677:Pds5b	UTSW	5	150716461	missense	possibly damaging	0.91
R6005:Pds5b	UTSW	5	150769776	splice site	probably null
R6139:Pds5b	UTSW	5	150800777	missense	possibly damaging	0.81
R6225:Pds5b	UTSW	5	150746618	missense	probably damaging	0.98
R6279:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6300:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6666:Pds5b	UTSW	5	150778166	missense	probably damaging	1.00
R6805:Pds5b	UTSW	5	150805561	splice site	probably null
R7038:Pds5b	UTSW	5	150800760	missense	probably benign	0.02
R7046:Pds5b	UTSW	5	150749920	missense	probably damaging	1.00
R7051:Pds5b	UTSW	5	150794282	missense	possibly damaging	0.78
R7138:Pds5b	UTSW	5	150800677	nonsense	probably null
R7255:Pds5b	UTSW	5	150796667	missense	probably benign	0.33
R7467:Pds5b	UTSW	5	150736327	missense	probably damaging	0.99
R7488:Pds5b	UTSW	5	150723337	missense	probably damaging	0.97
R7512:Pds5b	UTSW	5	150788342	missense	probably damaging	1.00
R7561:Pds5b	UTSW	5	150739318	critical splice donor site	probably null
R7576:Pds5b	UTSW	5	150778261	missense	probably damaging	1.00
R7889:Pds5b	UTSW	5	150792172	missense	probably damaging	1.00
R8059:Pds5b	UTSW	5	150807835	missense	unknown
R8211:Pds5b	UTSW	5	150728942	missense	possibly damaging	0.90
R8412:Pds5b	UTSW	5	150719959	missense	probably damaging	1.00
R8503:Pds5b	UTSW	5	150716507	missense	possibly damaging	0.95
R8556:Pds5b	UTSW	5	150792608	missense	probably benign
R8786:Pds5b	UTSW	5	150780669	missense	probably damaging	1.00
R8929:Pds5b	UTSW	5	150719914	missense	probably damaging	1.00
R8985:Pds5b	UTSW	5	150800774	missense	probably benign	0.38
R9184:Pds5b	UTSW	5	150800784	missense	probably benign	0.04
R9343:Pds5b	UTSW	5	150780721	missense	probably damaging	1.00
R9432:Pds5b	UTSW	5	150769791	missense	probably damaging	1.00
R9571:Pds5b	UTSW	5	150722506	missense	probably damaging	1.00
R9712:Pds5b	UTSW	5	150805663	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AACCCTTTGTAGGTGCTGTC -3'
(R):5'- ATCCTGTGCTATTGTACACCAGG -3'

Sequencing Primer
(F):5'- AACCCTTTGTAGGTGCTGTCTTTTAC -3'
(R):5'- CTGTGCTATTGTACACCAGGAACTAC -3'

Posted On

2020-09-15