Incidental Mutation 'R7982:Kbtbd12'
ID651262
Institutional Source Beutler Lab
Gene Symbol Kbtbd12
Ensembl Gene ENSMUSG00000033182
Gene Namekelch repeat and BTB (POZ) domain containing 12
SynonymsKlhdc6, 4933428M03Rik, 4833415F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location88545114-88637950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88618634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 71 (I71M)
Ref Sequence ENSEMBL: ENSMUSP00000139069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120933] [ENSMUST00000184664] [ENSMUST00000184878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120933
AA Change: I71M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112581
Gene: ENSMUSG00000033182
AA Change: I71M

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Kelch 384 434 9.15e-3 SMART
Kelch 435 490 4.3e-8 SMART
Kelch 491 550 1.01e-1 SMART
Kelch 551 601 1.92e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184664
AA Change: I71M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139069
Gene: ENSMUSG00000033182
AA Change: I71M

DomainStartEndE-ValueType
Pfam:BTB 19 77 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184878
SMART Domains Protein: ENSMUSP00000139333
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Kelch 30 67 9.94e-1 SMART
Kelch 68 127 1.01e-1 SMART
Kelch 128 178 1.92e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Kbtbd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Kbtbd12 APN 6 88618558 missense probably benign 0.08
IGL01845:Kbtbd12 APN 6 88613940 missense probably benign 0.16
IGL02447:Kbtbd12 APN 6 88618694 missense probably damaging 1.00
IGL02623:Kbtbd12 APN 6 88618389 missense probably damaging 1.00
IGL02851:Kbtbd12 APN 6 88618329 missense probably benign 0.18
R0334:Kbtbd12 UTSW 6 88617906 missense probably damaging 0.99
R1689:Kbtbd12 UTSW 6 88618585 missense probably damaging 1.00
R1712:Kbtbd12 UTSW 6 88618694 missense probably damaging 1.00
R1777:Kbtbd12 UTSW 6 88618060 missense probably benign 0.00
R2037:Kbtbd12 UTSW 6 88617797 missense probably benign 0.00
R3967:Kbtbd12 UTSW 6 88618506 missense probably benign 0.01
R4660:Kbtbd12 UTSW 6 88617790 missense probably benign 0.44
R4785:Kbtbd12 UTSW 6 88618021 missense probably damaging 1.00
R5224:Kbtbd12 UTSW 6 88617699 intron probably benign
R5568:Kbtbd12 UTSW 6 88618627 missense probably damaging 1.00
R6051:Kbtbd12 UTSW 6 88617948 missense possibly damaging 0.69
R6412:Kbtbd12 UTSW 6 88618656 missense probably damaging 1.00
R6525:Kbtbd12 UTSW 6 88614080 missense probably benign 0.29
R6776:Kbtbd12 UTSW 6 88618266 missense probably damaging 0.97
R7046:Kbtbd12 UTSW 6 88618515 missense possibly damaging 0.89
R7157:Kbtbd12 UTSW 6 88618668 missense probably damaging 1.00
R7224:Kbtbd12 UTSW 6 88613983 nonsense probably null
R7303:Kbtbd12 UTSW 6 88614112 missense unknown
R7650:Kbtbd12 UTSW 6 88618548 missense probably damaging 1.00
R7763:Kbtbd12 UTSW 6 88618197 missense probably benign 0.31
R8103:Kbtbd12 UTSW 6 88618681 missense probably damaging 1.00
R8195:Kbtbd12 UTSW 6 88617931 missense possibly damaging 0.64
R8305:Kbtbd12 UTSW 6 88618150 missense possibly damaging 0.50
Z1177:Kbtbd12 UTSW 6 88618668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCCATGTGGTCCATC -3'
(R):5'- TTCAAGGAGTATACCATGGAGTGC -3'

Sequencing Primer
(F):5'- GGCATCCATGTGGTCCATCATATAG -3'
(R):5'- ACCAGCATAGCTTGAACTTACTAG -3'
Posted On2020-09-15