Incidental Mutation 'R7982:Ppp6r1'
ID651263
Institutional Source Beutler Lab
Gene Symbol Ppp6r1
Ensembl Gene ENSMUSG00000052296
Gene Nameprotein phosphatase 6, regulatory subunit 1
SynonymsB430201G11Rik, Saps1, 2010309P17Rik, Pp6r1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4631495-4659019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4643158 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 181 (D181E)
Ref Sequence ENSEMBL: ENSMUSP00000066736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064099] [ENSMUST00000205374] [ENSMUST00000206532]
Predicted Effect probably benign
Transcript: ENSMUST00000064099
AA Change: D181E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205374
Predicted Effect probably benign
Transcript: ENSMUST00000206532
AA Change: D191E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Ppp6r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Ppp6r1 APN 7 4639987 splice site probably null
IGL02232:Ppp6r1 APN 7 4633342 missense probably damaging 0.98
IGL02674:Ppp6r1 APN 7 4646813 missense probably damaging 1.00
IGL02887:Ppp6r1 APN 7 4642212 missense probably damaging 1.00
IGL02990:Ppp6r1 APN 7 4643023 missense possibly damaging 0.83
IGL03135:Ppp6r1 APN 7 4642160 missense possibly damaging 0.90
IGL03399:Ppp6r1 APN 7 4643252 missense probably damaging 1.00
R0375:Ppp6r1 UTSW 7 4633287 missense probably benign 0.00
R0412:Ppp6r1 UTSW 7 4642214 missense probably damaging 0.98
R0760:Ppp6r1 UTSW 7 4639723 missense probably benign 0.00
R0883:Ppp6r1 UTSW 7 4639710 missense possibly damaging 0.89
R1478:Ppp6r1 UTSW 7 4640378 splice site probably null
R1515:Ppp6r1 UTSW 7 4643258 missense probably damaging 0.97
R1768:Ppp6r1 UTSW 7 4633692 critical splice donor site probably null
R1772:Ppp6r1 UTSW 7 4642031 missense probably benign 0.00
R4017:Ppp6r1 UTSW 7 4633744 missense probably benign 0.07
R4519:Ppp6r1 UTSW 7 4641046 splice site probably null
R4795:Ppp6r1 UTSW 7 4641054 missense possibly damaging 0.66
R4849:Ppp6r1 UTSW 7 4643207 missense probably damaging 1.00
R5214:Ppp6r1 UTSW 7 4643177 missense probably benign 0.00
R5416:Ppp6r1 UTSW 7 4639748 missense possibly damaging 0.96
R5643:Ppp6r1 UTSW 7 4633772 missense probably benign 0.30
R5765:Ppp6r1 UTSW 7 4642208 missense possibly damaging 0.67
R6126:Ppp6r1 UTSW 7 4643377 missense possibly damaging 0.48
R6854:Ppp6r1 UTSW 7 4632396 missense probably benign 0.02
R6932:Ppp6r1 UTSW 7 4633292 missense possibly damaging 0.84
R7011:Ppp6r1 UTSW 7 4646826 missense probably damaging 1.00
R7486:Ppp6r1 UTSW 7 4639900 missense probably benign 0.17
R7500:Ppp6r1 UTSW 7 4636130 missense probably benign 0.04
R8769:Ppp6r1 UTSW 7 4641290 missense probably benign
X0062:Ppp6r1 UTSW 7 4640307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGGAGATGTCAGCCAGCAC -3'
(R):5'- AAGACAGACCAGGTGCCTACTG -3'

Sequencing Primer
(F):5'- GATGTCAGCCAGCACTCACATTG -3'
(R):5'- TACCTCAGCCATCATGGA -3'
Posted On2020-09-15