Incidental Mutation 'R7982:Rras2'
ID651268
Institutional Source Beutler Lab
Gene Symbol Rras2
Ensembl Gene ENSMUSG00000055723
Gene Namerelated RAS viral (r-ras) oncogene 2
Synonyms2610016H24Rik, TC21
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114046782-114117781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114058951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 92 (V92D)
Ref Sequence ENSEMBL: ENSMUSP00000069752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069449] [ENSMUST00000210075]
Predicted Effect probably damaging
Transcript: ENSMUST00000069449
AA Change: V92D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069752
Gene: ENSMUSG00000055723
AA Change: V92D

DomainStartEndE-ValueType
RAS 12 178 1.02e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210075
AA Change: V92D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygote and heterozygote null mice are lymphopenic, resulting from diminished homeostatic proliferation and impaired T cell and B cell survival. Mice homozygous for a gene trap insertion exhibit retinal degeneration, and increased total body mass and total body fat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Rras2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Rras2 APN 7 114060397 missense probably damaging 1.00
IGL02028:Rras2 APN 7 114060362 missense probably benign 0.01
IGL02108:Rras2 APN 7 114060388 missense probably damaging 1.00
R0017:Rras2 UTSW 7 114048255 splice site probably benign
R0017:Rras2 UTSW 7 114048255 splice site probably benign
R4718:Rras2 UTSW 7 114050349 missense probably benign 0.00
R5371:Rras2 UTSW 7 114050337 missense probably damaging 1.00
R5534:Rras2 UTSW 7 114050415 missense possibly damaging 0.47
R7871:Rras2 UTSW 7 114117548 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCTAGCACTGCTAACTTGAG -3'
(R):5'- TCTGCCTCTGGTGCTAGGAATG -3'

Sequencing Primer
(F):5'- ACTGCTAACTTGAGGTTTTTATTAGC -3'
(R):5'- GACAGGAATGCATTGCCTCTC -3'
Posted On2020-09-15