Incidental Mutation 'R7982:Mc1r'
ID651272
Institutional Source Beutler Lab
Gene Symbol Mc1r
Ensembl Gene ENSMUSG00000074037
Gene Namemelanocortin 1 receptor
Synonymsextension recessive yellow, e, Mshra
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123407107-123410744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123408140 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 211 (R211G)
Ref Sequence ENSEMBL: ENSMUSP00000095929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000098324] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212571] [ENSMUST00000212743] [ENSMUST00000212880]
Predicted Effect probably benign
Transcript: ENSMUST00000071134
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098324
AA Change: R211G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095929
Gene: ENSMUSG00000074037
AA Change: R211G

DomainStartEndE-ValueType
Pfam:7tm_4 43 188 1.3e-13 PFAM
Pfam:7TM_GPCR_Srsx 47 311 1e-7 PFAM
Pfam:7tm_1 53 296 2.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212880
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Spontaneous(6) Chemically induced(2)
Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity.

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Mc1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Mc1r APN 8 123408050 missense probably damaging 1.00
IGL02878:Mc1r APN 8 123407630 missense probably damaging 1.00
deer UTSW 8 123407958 missense probably damaging 1.00
R1240:Mc1r UTSW 8 123408260 missense probably damaging 1.00
R1871:Mc1r UTSW 8 123407536 missense probably benign
R2071:Mc1r UTSW 8 123408369 missense possibly damaging 0.84
R4006:Mc1r UTSW 8 123407637 missense probably damaging 1.00
R4226:Mc1r UTSW 8 123407856 missense possibly damaging 0.88
R4865:Mc1r UTSW 8 123407516 missense probably benign 0.25
R6652:Mc1r UTSW 8 123407631 missense probably damaging 1.00
R6765:Mc1r UTSW 8 123407696 missense probably damaging 1.00
R7580:Mc1r UTSW 8 123408167 missense probably damaging 1.00
R7609:Mc1r UTSW 8 123408293 missense probably damaging 0.98
R8695:Mc1r UTSW 8 123408377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGCGCTGCGTTATCACAG -3'
(R):5'- TGAAGTTCTTGAAGATGCAGCTG -3'

Sequencing Primer
(F):5'- GTTATCACAGCATCGTGACG -3'
(R):5'- CAGCTGCAGGTGGGGTG -3'
Posted On2020-09-15