Incidental Mutation 'R7982:Exoc8'
ID651273
Institutional Source Beutler Lab
Gene Symbol Exoc8
Ensembl Gene ENSMUSG00000074030
Gene Nameexocyst complex component 8
SynonymsSEC84, EXO84, Exo84p
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124893108-124897705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124896410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 406 (V406E)
Ref Sequence ENSEMBL: ENSMUSP00000095915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably benign
Transcript: ENSMUST00000034467
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000098312
AA Change: V406E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030
AA Change: V406E

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the exocyst complex, an evolutionarily conserved multi-protein complex that plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. This protein is a target of activated Ral subfamily of GTPases and thereby regulates exocytosis by tethering vesicles to the plasma membrane. Mutations in this gene may be related to Joubert syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Exoc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Exoc8 APN 8 124896872 missense probably damaging 1.00
IGL01444:Exoc8 APN 8 124895841 missense possibly damaging 0.84
IGL01655:Exoc8 APN 8 124896228 missense probably benign 0.03
IGL01881:Exoc8 APN 8 124896351 missense probably damaging 1.00
IGL02952:Exoc8 APN 8 124897536 missense probably benign 0.02
R0683:Exoc8 UTSW 8 124895633 missense probably damaging 0.99
R2051:Exoc8 UTSW 8 124895480 missense probably benign 0.15
R2140:Exoc8 UTSW 8 124897415 missense possibly damaging 0.84
R2197:Exoc8 UTSW 8 124895738 missense probably damaging 1.00
R2209:Exoc8 UTSW 8 124896179 nonsense probably null
R4659:Exoc8 UTSW 8 124897532 missense probably damaging 1.00
R4707:Exoc8 UTSW 8 124897470 missense possibly damaging 0.93
R4724:Exoc8 UTSW 8 124897250 missense probably benign
R4764:Exoc8 UTSW 8 124897575 missense possibly damaging 0.94
R5159:Exoc8 UTSW 8 124896213 missense probably benign 0.00
R5976:Exoc8 UTSW 8 124896653 missense probably benign 0.02
R6566:Exoc8 UTSW 8 124896044 missense probably damaging 1.00
R6602:Exoc8 UTSW 8 124896411 missense probably damaging 1.00
R7246:Exoc8 UTSW 8 124896417 nonsense probably null
R7341:Exoc8 UTSW 8 124896581 missense probably damaging 1.00
R7440:Exoc8 UTSW 8 124895781 missense probably benign
R7745:Exoc8 UTSW 8 124895819 missense probably benign
R8499:Exoc8 UTSW 8 124897110 missense probably benign 0.01
R8504:Exoc8 UTSW 8 124895970 missense probably benign 0.17
Z1176:Exoc8 UTSW 8 124896666 missense possibly damaging 0.52
Z1177:Exoc8 UTSW 8 124897186 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCAAAGTCCGTCTCAAACTCTC -3'
(R):5'- ATGTTTGTATTGCACAGAGGGAC -3'

Sequencing Primer
(F):5'- AACTCTCTCGCGGTCTCTAGGAG -3'
(R):5'- TATTGCACAGAGGGACTTTGAG -3'
Posted On2020-09-15