Incidental Mutation 'R7982:Tarbp1'
ID651274
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126444301 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 987 (S987T)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably damaging
Transcript: ENSMUST00000170518
AA Change: S987T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: S987T

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 126444195 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTCTGATCGCGCCTAAACAC -3'
(R):5'- GGATCCATCATCTGAAAGCGC -3'

Sequencing Primer
(F):5'- GATCGCGCCTAAACACTGTTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2020-09-15