Incidental Mutation 'R7982:Cand1'
ID651280
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Namecullin associated and neddylation disassociated 1
SynonymsD10Ertd516e, 2310038O07Rik, 6330512O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location119199255-119240055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119216473 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 242 (S242R)
Ref Sequence ENSEMBL: ENSMUSP00000020315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315] [ENSMUST00000126373]
Predicted Effect probably damaging
Transcript: ENSMUST00000020315
AA Change: S242R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: S242R

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126373
SMART Domains Protein: ENSMUSP00000115234
Gene: ENSMUSG00000020114

DomainStartEndE-ValueType
Pfam:HEAT 56 86 2.1e-5 PFAM
low complexity region 124 135 N/A INTRINSIC
Pfam:HEAT_EZ 155 209 3.7e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119211135 missense probably benign 0.00
IGL00917:Cand1 APN 10 119210936 missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119208167 missense probably damaging 0.96
IGL02016:Cand1 APN 10 119212568 missense probably damaging 0.98
IGL02271:Cand1 APN 10 119211721 missense probably damaging 1.00
IGL02282:Cand1 APN 10 119210709 missense probably benign 0.26
IGL02494:Cand1 APN 10 119213617 missense probably benign
IGL02527:Cand1 APN 10 119206807 missense probably damaging 1.00
IGL02675:Cand1 APN 10 119219697 missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119213638 missense probably damaging 1.00
R0114:Cand1 UTSW 10 119216522 missense probably benign
R0667:Cand1 UTSW 10 119216520 missense probably benign 0.00
R1589:Cand1 UTSW 10 119213566 missense probably damaging 0.97
R1591:Cand1 UTSW 10 119211869 missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119210014 missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119208306 missense probably benign 0.05
R1937:Cand1 UTSW 10 119203020 missense probably damaging 1.00
R1951:Cand1 UTSW 10 119208020 splice site probably benign
R1990:Cand1 UTSW 10 119210067 missense probably damaging 1.00
R3522:Cand1 UTSW 10 119239197 missense probably benign 0.01
R4207:Cand1 UTSW 10 119211845 missense probably damaging 1.00
R4209:Cand1 UTSW 10 119211558 missense probably benign 0.24
R4502:Cand1 UTSW 10 119216667 missense probably benign
R4791:Cand1 UTSW 10 119210702 missense probably benign 0.02
R4841:Cand1 UTSW 10 119213546 critical splice donor site probably null
R4842:Cand1 UTSW 10 119213546 critical splice donor site probably null
R5326:Cand1 UTSW 10 119212028 missense probably benign
R5606:Cand1 UTSW 10 119211454 missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119215323 missense possibly damaging 0.93
R5768:Cand1 UTSW 10 119211005 missense probably benign 0.06
R5884:Cand1 UTSW 10 119213765 missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119210028 missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119218010 missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119211992 missense possibly damaging 0.67
R6838:Cand1 UTSW 10 119210030 missense probably benign 0.21
R7058:Cand1 UTSW 10 119211754 missense probably benign 0.00
R7342:Cand1 UTSW 10 119211787 missense possibly damaging 0.64
R7425:Cand1 UTSW 10 119216243 missense probably benign 0.00
R7705:Cand1 UTSW 10 119212438 critical splice donor site probably null
R7812:Cand1 UTSW 10 119217959 missense probably benign 0.04
R7916:Cand1 UTSW 10 119216588 missense probably benign 0.00
R8117:Cand1 UTSW 10 119206816 missense probably damaging 1.00
Z1176:Cand1 UTSW 10 119239194 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCCCCAGAGGTAAAAGTG -3'
(R):5'- AGCCCTAGACTTGCAGTGAG -3'

Sequencing Primer
(F):5'- CCAAATGCTTTCAAAGTAAATGAGGC -3'
(R):5'- CCCTAGACTTGCAGTGAGGAAAAG -3'
Posted On2020-09-15