Incidental Mutation 'R7982:Synrg'
ID651284
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84019818 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 859 (D859N)
Ref Sequence ENSEMBL: ENSMUSP00000090510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably benign
Transcript: ENSMUST00000049714
AA Change: D1015N

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940
AA Change: D1015N

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092834
AA Change: D859N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940
AA Change: D859N

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183456
AA Change: D1038N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940
AA Change: D1038N

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183714
AA Change: D937N

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940
AA Change: D937N

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
R7794:Synrg UTSW 11 84019574 missense probably benign 0.10
R8327:Synrg UTSW 11 84008905 missense probably benign 0.26
R8811:Synrg UTSW 11 84019584 missense probably benign 0.16
R8926:Synrg UTSW 11 83990741 missense possibly damaging 0.89
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCTCTGAAAACATCAC -3'
(R):5'- TTCAGTGGAAGAAGCCCATAGG -3'

Sequencing Primer
(F):5'- ATGTCATCTCTCTCCAAAGGATCGG -3'
(R):5'- TAGGGAGAAAATCTTACCTTGAACAG -3'
Posted On2020-09-15