Incidental Mutation 'R7982:Cdc42ep4'
ID651287
Institutional Source Beutler Lab
Gene Symbol Cdc42ep4
Ensembl Gene ENSMUSG00000041598
Gene NameCDC42 effector protein (Rho GTPase binding) 4
SynonymsCEP4, 1500041M20Rik, Borg4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location113726850-113751881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113728576 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 330 (R330G)
Ref Sequence ENSEMBL: ENSMUSP00000060227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053536] [ENSMUST00000106616] [ENSMUST00000131488] [ENSMUST00000153453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053536
AA Change: R330G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060227
Gene: ENSMUSG00000041598
AA Change: R330G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1e-13 PFAM
Pfam:BORG_CEP 110 224 1e-35 PFAM
low complexity region 280 308 N/A INTRINSIC
low complexity region 340 346 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106616
AA Change: R330G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102227
Gene: ENSMUSG00000041598
AA Change: R330G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 2.6e-14 PFAM
Pfam:BORG_CEP 110 219 1.6e-24 PFAM
low complexity region 280 308 N/A INTRINSIC
low complexity region 340 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131488
SMART Domains Protein: ENSMUSP00000114599
Gene: ENSMUSG00000041598

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1.1e-13 PFAM
Pfam:BORG_CEP 110 194 7.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153453
SMART Domains Protein: ENSMUSP00000120316
Gene: ENSMUSG00000041598

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the CDC42-binding protein family. Members of this family interact with Rho family GTPases and regulate the organization of the actin cytoskeleton. This protein has been shown to bind both CDC42 and TC10 GTPases in a GTP-dependent manner. When overexpressed in fibroblasts, this protein was able to induce pseudopodia formation, which suggested a role in inducing actin filament assembly and cell shape control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired glutamate clearance and motor learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Cdc42ep4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cdc42ep4 APN 11 113729502 missense probably damaging 1.00
IGL01715:Cdc42ep4 APN 11 113729442 missense probably damaging 1.00
IGL01960:Cdc42ep4 APN 11 113729004 missense probably benign
IGL02118:Cdc42ep4 APN 11 113729116 missense probably benign 0.02
IGL02983:Cdc42ep4 APN 11 113729169 missense probably benign 0.13
R0621:Cdc42ep4 UTSW 11 113728696 missense probably damaging 1.00
R1590:Cdc42ep4 UTSW 11 113728566 missense possibly damaging 0.82
R1663:Cdc42ep4 UTSW 11 113729451 missense probably damaging 1.00
R1791:Cdc42ep4 UTSW 11 113729337 missense probably damaging 1.00
R2360:Cdc42ep4 UTSW 11 113728702 missense probably damaging 1.00
R6017:Cdc42ep4 UTSW 11 113729366 missense probably benign 0.03
R6053:Cdc42ep4 UTSW 11 113728986 missense probably damaging 1.00
R6967:Cdc42ep4 UTSW 11 113729172 missense possibly damaging 0.79
R7066:Cdc42ep4 UTSW 11 113729218 missense probably damaging 1.00
R7082:Cdc42ep4 UTSW 11 113729118 missense probably benign
R7556:Cdc42ep4 UTSW 11 113728540 missense probably damaging 1.00
R8964:Cdc42ep4 UTSW 11 113729452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACCTACAGAGTAAGGTCAAAG -3'
(R):5'- TCCTCTAGGGAGACAGGAAAGC -3'

Sequencing Primer
(F):5'- CTACAGAGTAAGGTCAAAGGTCATAG -3'
(R):5'- ACCAGGCCTCTATGCTGC -3'
Posted On2020-09-15