Incidental Mutation 'R7982:Olfr1535'
ID651290
Institutional Source Beutler Lab
Gene Symbol Olfr1535
Ensembl Gene ENSMUSG00000054890
Gene Nameolfactory receptor 1535
SynonymsMOR256-36, Olfr1365, MOR256-63, GA_x6K02T2QHY8-11688984-11689964, MOR256-36
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21553894-21559893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21555966 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 19 (N19D)
Ref Sequence ENSEMBL: ENSMUSP00000149589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068163] [ENSMUST00000217519]
Predicted Effect probably benign
Transcript: ENSMUST00000068163
AA Change: N19D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064142
Gene: ENSMUSG00000054890
AA Change: N19D

DomainStartEndE-ValueType
Pfam:7tm_4 31 320 5.4e-46 PFAM
Pfam:7tm_1 41 302 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217519
AA Change: N19D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Olfr1535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Olfr1535 APN 13 21555219 missense probably damaging 0.98
IGL01866:Olfr1535 APN 13 21555173 missense probably benign 0.07
IGL02289:Olfr1535 APN 13 21555588 missense probably benign 0.02
IGL02350:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02357:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02793:Olfr1535 APN 13 21556002 missense probably damaging 1.00
IGL02875:Olfr1535 APN 13 21556002 missense probably damaging 1.00
R0785:Olfr1535 UTSW 13 21555788 missense probably benign 0.02
R1773:Olfr1535 UTSW 13 21555812 missense probably damaging 1.00
R3429:Olfr1535 UTSW 13 21555805 nonsense probably null
R3430:Olfr1535 UTSW 13 21555805 nonsense probably null
R4232:Olfr1535 UTSW 13 21555461 missense probably damaging 0.98
R4883:Olfr1535 UTSW 13 21555488 missense probably benign 0.22
R5586:Olfr1535 UTSW 13 21555096 missense probably damaging 1.00
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6542:Olfr1535 UTSW 13 21555507 missense probably damaging 0.99
R7014:Olfr1535 UTSW 13 21555938 missense probably benign 0.02
R7579:Olfr1535 UTSW 13 21556006 missense probably benign 0.08
R7598:Olfr1535 UTSW 13 21555188 missense probably damaging 1.00
R8239:Olfr1535 UTSW 13 21555618 missense probably benign 0.01
R8339:Olfr1535 UTSW 13 21555826 missense probably damaging 0.99
R8698:Olfr1535 UTSW 13 21555720 missense probably damaging 1.00
R8956:Olfr1535 UTSW 13 21555999 missense probably benign 0.00
RF051:Olfr1535 UTSW 13 21555523 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTAAACAGCGTCTGAGGGAC -3'
(R):5'- CAACACAGCAGCTTCTTGCAAG -3'

Sequencing Primer
(F):5'- ACAGTGCGAGCTGTCAAAC -3'
(R):5'- CACAGGTAGACTGCAATG -3'
Posted On2020-09-15