Incidental Mutation 'R7982:Cyp1b1'
ID651296
Institutional Source Beutler Lab
Gene Symbol Cyp1b1
Ensembl Gene ENSMUSG00000024087
Gene Namecytochrome P450, family 1, subfamily b, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location79706953-79715041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79710490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 412 (Y412C)
Ref Sequence ENSEMBL: ENSMUSP00000024894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024894]
Predicted Effect probably damaging
Transcript: ENSMUST00000024894
AA Change: Y412C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024894
Gene: ENSMUSG00000024087
AA Change: Y412C

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:p450 51 520 1.3e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from the acute bone marrow cytotoxic and preleukemic effects of DMBA, show a decreased incidence of DMBA-induced lymphomas, and display background-sensitive ocular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Cyp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0387:Cyp1b1 UTSW 17 79713774 missense probably benign
R0400:Cyp1b1 UTSW 17 79713587 missense probably damaging 1.00
R0456:Cyp1b1 UTSW 17 79710275 missense probably benign 0.02
R0681:Cyp1b1 UTSW 17 79713846 missense probably damaging 0.97
R2851:Cyp1b1 UTSW 17 79710220 missense probably benign 0.00
R2897:Cyp1b1 UTSW 17 79713731 missense probably benign 0.00
R4706:Cyp1b1 UTSW 17 79713342 missense possibly damaging 0.86
R5070:Cyp1b1 UTSW 17 79710611 missense probably benign
R6104:Cyp1b1 UTSW 17 79710205 missense probably damaging 1.00
R6195:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
R6233:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
R7440:Cyp1b1 UTSW 17 79713557 missense probably damaging 0.99
R7770:Cyp1b1 UTSW 17 79713299 missense probably damaging 1.00
R7894:Cyp1b1 UTSW 17 79714215 missense possibly damaging 0.81
R8241:Cyp1b1 UTSW 17 79713794 missense probably damaging 1.00
R8528:Cyp1b1 UTSW 17 79710564 missense probably damaging 1.00
R8814:Cyp1b1 UTSW 17 79713359 missense probably benign 0.02
X0067:Cyp1b1 UTSW 17 79710691 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCATCTTAGACAGTTCCTCACC -3'
(R):5'- AAAACAGATACCCGGATGTTCAG -3'

Sequencing Primer
(F):5'- TAGACAGTTCCTCACCGATGC -3'
(R):5'- ATGTTCAGGCCCGCGTG -3'
Posted On2020-09-15