Incidental Mutation 'R7982:Pcdhb6'
ID651297
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Nameprotocadherin beta 6
SynonymsPcdhb5B, PcdhbF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37333921-37337674 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 37334220 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 65 (R65*)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
Predicted Effect probably null
Transcript: ENSMUST00000061717
AA Change: R65*
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: R65*

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37334224 missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37335820 missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37335682 missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37335454 missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37334694 missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37335587 nonsense probably null
IGL03144:Pcdhb6 APN 18 37334406 missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37336152 missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37334532 missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37336137 missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37335247 missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37335114 missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37335334 missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37334587 missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37336231 missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37335169 missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37336140 missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37336206 missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37335373 missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37334328 missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37334335 missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37334730 missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37334349 missense probably benign
R5556:Pcdhb6 UTSW 18 37334389 missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37334700 missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37334913 missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37335925 missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37335921 nonsense probably null
R6528:Pcdhb6 UTSW 18 37334503 missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37335145 missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37336276 missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37335478 missense probably benign
R7313:Pcdhb6 UTSW 18 37335208 missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37335172 missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37335279 missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37335606 missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37334509 missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37336312 missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37334554 missense probably benign 0.00
R8818:Pcdhb6 UTSW 18 37335784 missense probably benign 0.06
R8917:Pcdhb6 UTSW 18 37335378 missense possibly damaging 0.92
Z1088:Pcdhb6 UTSW 18 37335146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCACTGCTCTTTGGATC -3'
(R):5'- TGAGCTGCAGTTCAGTTTGAAAG -3'

Sequencing Primer
(F):5'- GAAGCACTGCTCTTTGGATCATAGC -3'
(R):5'- AGAACTGCACAGGGTTTTCTAG -3'
Posted On2020-09-15