Incidental Mutation 'R7983:Sult2a4'
ID651316
Institutional Source Beutler Lab
Gene Symbol Sult2a4
Ensembl Gene ENSMUSG00000074377
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
SynonymsGm5584
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7983 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location13909676-13989607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13915227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 219 (S219F)
Ref Sequence ENSEMBL: ENSMUSP00000104160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108520] [ENSMUST00000165167]
Predicted Effect probably damaging
Transcript: ENSMUST00000108520
AA Change: S219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104160
Gene: ENSMUSG00000074377
AA Change: S219F

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 5 205 1.5e-10 PFAM
Pfam:Sulfotransfer_1 34 278 1.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165167
AA Change: S218F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130490
Gene: ENSMUSG00000074377
AA Change: S218F

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 33 277 1.3e-82 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C A 6: 96,165,907 G52V probably damaging Het
2410089E03Rik T A 15: 8,221,815 V1857E probably benign Het
Casd1 G T 6: 4,624,472 E422* probably null Het
Ccdc7a T C 8: 128,881,078 T1007A possibly damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cds2 T G 2: 132,263,510 probably null Het
Cfap100 G A 6: 90,415,705 T141I Het
Chd7 T A 4: 8,752,628 M375K unknown Het
Chd7 T A 4: 8,844,609 S1573T possibly damaging Het
Crybb2 T C 5: 113,062,080 E139G probably benign Het
Csn2 T C 5: 87,694,497 T224A probably benign Het
Csnk2b T C 17: 35,116,328 H231R possibly damaging Het
Cthrc1 A G 15: 39,077,155 D51G probably benign Het
Cyp2a5 A T 7: 26,840,441 T305S probably benign Het
Cyp4a29 A T 4: 115,250,902 D307V probably damaging Het
Dhrs7b T C 11: 60,852,461 V188A possibly damaging Het
Dna2 A G 10: 62,955,394 D224G probably benign Het
Dnah7b T A 1: 46,243,424 L2906M probably damaging Het
Eif4g3 A T 4: 138,151,593 E545D probably benign Het
Foxq1 T C 13: 31,559,989 F358S possibly damaging Het
Galnt16 C T 12: 80,601,824 H557Y probably benign Het
Kcnb2 T C 1: 15,312,780 M110T probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Nalcn T C 14: 123,592,997 I144V probably benign Het
Napsa T A 7: 44,585,327 N295K possibly damaging Het
Olfr172 G A 16: 58,761,014 S54F probably benign Het
Olfr704 T C 7: 106,865,751 V257A probably benign Het
Plch1 T C 3: 63,707,743 D778G probably damaging Het
Pnlip G A 19: 58,680,059 V361I probably benign Het
Pou4f2 G T 8: 78,434,939 A345E probably benign Het
Prr11 C T 11: 87,091,811 D365N possibly damaging Het
Ptprq G T 10: 107,608,411 S1444* probably null Het
R3hdm4 A T 10: 79,912,723 V129E probably damaging Het
Retnlg T C 16: 48,872,898 S13P probably damaging Het
Rgmb T C 17: 15,820,927 T133A possibly damaging Het
Rin3 A C 12: 102,369,159 H443P probably benign Het
Rnf152 T C 1: 105,284,364 D156G probably benign Het
Sfmbt1 A G 14: 30,797,716 probably null Het
Slc25a46 G A 18: 31,583,430 R340C probably damaging Het
Sp4 A T 12: 118,301,232 M1K probably null Het
Ss18l2 T C 9: 121,712,609 I64T probably damaging Het
Tnip3 A C 6: 65,538,646 D25A probably damaging Het
Trac A G 14: 54,220,757 T79A Het
Vmn2r36 A G 7: 7,902,416 L16P probably damaging Het
Zswim2 A G 2: 83,923,567 probably null Het
Other mutations in Sult2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Sult2a4 APN 7 13984945 missense probably damaging 1.00
IGL00835:Sult2a4 APN 7 13909789 missense probably benign 0.01
IGL02078:Sult2a4 APN 7 13989544 missense probably benign 0.02
IGL02409:Sult2a4 APN 7 13984919 nonsense probably null
IGL02970:Sult2a4 APN 7 13909906 splice site probably benign
IGL03201:Sult2a4 APN 7 13931767 missense probably damaging 0.97
R0827:Sult2a4 UTSW 7 13984961 missense probably benign 0.03
R1484:Sult2a4 UTSW 7 13909801 missense probably benign
R1523:Sult2a4 UTSW 7 13909860 nonsense probably null
R1613:Sult2a4 UTSW 7 13989495 missense probably damaging 0.98
R2127:Sult2a4 UTSW 7 13915260 missense probably damaging 0.99
R2372:Sult2a4 UTSW 7 13915300 missense probably benign 0.15
R3161:Sult2a4 UTSW 7 13989471 missense probably benign 0.17
R5181:Sult2a4 UTSW 7 13988391 missense probably benign 0.04
R7124:Sult2a4 UTSW 7 13988395 nonsense probably null
R8214:Sult2a4 UTSW 7 13989476 missense probably benign 0.10
X0028:Sult2a4 UTSW 7 13988241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGAAGCTATCACTGATGAGC -3'
(R):5'- TGAGTGTGAGTCCTTTCCGC -3'

Sequencing Primer
(F):5'- TGAGCAGTGACTCTTAGTATATTTCC -3'
(R):5'- TGATGATGCACTTTTCACAACAC -3'
Posted On2020-09-15