Incidental Mutation 'R7983:Dna2'
ID651323
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7983 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62955394 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092462] [ENSMUST00000131422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092462
AA Change: D224G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875
AA Change: D224G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131422
AA Change: D224G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875
AA Change: D224G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C A 6: 96,165,907 G52V probably damaging Het
2410089E03Rik T A 15: 8,221,815 V1857E probably benign Het
Casd1 G T 6: 4,624,472 E422* probably null Het
Ccdc7a T C 8: 128,881,078 T1007A possibly damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cds2 T G 2: 132,263,510 probably null Het
Cfap100 G A 6: 90,415,705 T141I Het
Chd7 T A 4: 8,752,628 M375K unknown Het
Chd7 T A 4: 8,844,609 S1573T possibly damaging Het
Crybb2 T C 5: 113,062,080 E139G probably benign Het
Csn2 T C 5: 87,694,497 T224A probably benign Het
Csnk2b T C 17: 35,116,328 H231R possibly damaging Het
Cthrc1 A G 15: 39,077,155 D51G probably benign Het
Cyp2a5 A T 7: 26,840,441 T305S probably benign Het
Cyp4a29 A T 4: 115,250,902 D307V probably damaging Het
Dhrs7b T C 11: 60,852,461 V188A possibly damaging Het
Dnah7b T A 1: 46,243,424 L2906M probably damaging Het
Eif4g3 A T 4: 138,151,593 E545D probably benign Het
Foxq1 T C 13: 31,559,989 F358S possibly damaging Het
Galnt16 C T 12: 80,601,824 H557Y probably benign Het
Kcnb2 T C 1: 15,312,780 M110T probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Nalcn T C 14: 123,592,997 I144V probably benign Het
Napsa T A 7: 44,585,327 N295K possibly damaging Het
Olfr172 G A 16: 58,761,014 S54F probably benign Het
Olfr704 T C 7: 106,865,751 V257A probably benign Het
Plch1 T C 3: 63,707,743 D778G probably damaging Het
Pnlip G A 19: 58,680,059 V361I probably benign Het
Pou4f2 G T 8: 78,434,939 A345E probably benign Het
Prr11 C T 11: 87,091,811 D365N possibly damaging Het
Ptprq G T 10: 107,608,411 S1444* probably null Het
R3hdm4 A T 10: 79,912,723 V129E probably damaging Het
Retnlg T C 16: 48,872,898 S13P probably damaging Het
Rgmb T C 17: 15,820,927 T133A possibly damaging Het
Rin3 A C 12: 102,369,159 H443P probably benign Het
Rnf152 T C 1: 105,284,364 D156G probably benign Het
Sfmbt1 A G 14: 30,797,716 probably null Het
Slc25a46 G A 18: 31,583,430 R340C probably damaging Het
Sp4 A T 12: 118,301,232 M1K probably null Het
Ss18l2 T C 9: 121,712,609 I64T probably damaging Het
Sult2a4 G A 7: 13,915,227 S219F probably damaging Het
Tnip3 A C 6: 65,538,646 D25A probably damaging Het
Trac A G 14: 54,220,757 T79A Het
Vmn2r36 A G 7: 7,902,416 L16P probably damaging Het
Zswim2 A G 2: 83,923,567 probably null Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1084:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1562:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5567:Dna2 UTSW 10 62966673 missense possibly damaging 0.89
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6820:Dna2 UTSW 10 62964904 missense possibly damaging 0.93
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7508:Dna2 UTSW 10 62971993 splice site probably null
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R8498:Dna2 UTSW 10 62973315 missense probably benign 0.12
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGGAAACATCTGTTCATTAGCC -3'
(R):5'- TACAAAGCTCTGAATTGGCTGTC -3'

Sequencing Primer
(F):5'- AAACATCTGTTCATTAGCCTGTTTCG -3'
(R):5'- AGGCCAGCCTGGTTTAATAC -3'
Posted On2020-09-15