Mutagenetix > Incidental Mutation

Incidental Mutation 'R7984:Trmt1l'

651350

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7984 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 151435738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 116 (Q116H)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000065625
AA Change: Q116H

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: Q116H

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000189655

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1e1	G	T	13: 4,595,680	H226N	probably damaging	Het
Aldh1a7	T	C	19: 20,709,400	D283G	probably damaging	Het
Angel1	T	C	12: 86,720,294	D436G	probably benign	Het
Ank1	G	A	8: 23,088,966	R314Q	probably damaging	Het
Apbb2	T	C	5: 66,307,692	E629G	probably damaging	Het
Card9	T	G	2: 26,356,772	I355L	probably benign	Het
Cdon	C	T	9: 35,503,302	P1158S	probably benign	Het
Cpne7	T	G	8: 123,119,722	V91G	possibly damaging	Het
Dlc1	T	A	8: 36,938,318	T106S	possibly damaging	Het
Dnah1	A	T	14: 31,267,815	F3248Y	probably damaging	Het
Dnah7a	A	T	1: 53,504,218	D2264E	probably benign	Het
Dock7	A	T	4: 98,989,066	N1078K	unknown	Het
Emc1	T	A	4: 139,375,449	L973H	probably damaging	Het
Fer1l5	T	A	1: 36,408,621	L955Q	possibly damaging	Het
Fpr-rs7	T	C	17: 20,113,409	N273S	probably benign	Het
Gle1	T	A	2: 29,938,576	Y137N	probably damaging	Het
Grik4	G	A	9: 42,671,261	Q130*	probably null	Het
Hcn1	C	T	13: 117,976,073	Q858*	probably null	Het
Heg1	A	C	16: 33,763,575	S76R	possibly damaging	Het
Ikbke	T	A	1: 131,275,786	E50V	probably null	Het
Itga5	G	A	15: 103,355,952	P297S	probably damaging	Het
Kcng1	C	A	2: 168,262,486	R480L	possibly damaging	Het
Kdm3b	G	T	18: 34,823,699	E1236*	probably null	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Lrp5	A	G	19: 3,612,342	F894L	probably damaging	Het
Lrrk1	T	C	7: 66,300,729		probably null	Het
Man2a2	T	G	7: 80,353,308	T1018P	probably damaging	Het
Mctp2	T	C	7: 72,103,189	Q772R	possibly damaging	Het
Meioc	T	A	11: 102,674,606	N293K	possibly damaging	Het
Mrps24	A	T	11: 5,707,495	C34S	possibly damaging	Het
Nek1	G	T	8: 61,121,053	E1112*	probably null	Het
Nt5dc2	A	G	14: 31,138,818	S317G	probably damaging	Het
Obscn	G	T	11: 59,106,325	Q1492K	possibly damaging	Het
Olfr1160	T	A	2: 88,006,625	N42I	probably damaging	Het
Olfr1413	A	G	1: 92,573,422	I84V	probably benign	Het
Olfr47	T	G	6: 43,235,796	S63A	probably damaging	Het
Olfr677	T	C	7: 105,056,432	F62S	probably damaging	Het
Olfr816	A	G	10: 129,912,072	F69L	probably benign	Het
Olfr883	A	G	9: 38,025,859	T18A	probably damaging	Het
P2ry12	T	A	3: 59,217,601	I218F	probably damaging	Het
Paip1	C	T	13: 119,430,162	Q11*	probably null	Het
Pcdhga3	C	A	18: 37,676,496	D667E	probably benign	Het
Pcnx2	T	G	8: 125,759,126	E1911A	probably benign	Het
Pibf1	T	C	14: 99,221,627	L678P	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Prickle2	T	C	6: 92,410,874	T516A	probably benign	Het
Prl2c1	G	A	13: 27,855,327		probably null	Het
Rnf112	A	G	11: 61,449,480	V656A	possibly damaging	Het
Siglecf	A	C	7: 43,355,231		probably null	Het
Slc24a1	A	T	9: 64,949,529	L32*	probably null	Het
Slc7a1	A	G	5: 148,342,110	V284A	possibly damaging	Het
Slco5a1	T	A	1: 12,881,384	H565L	probably damaging	Het
Slit2	A	G	5: 48,176,123		probably benign	Het
Sulf1	A	G	1: 12,859,273	T255A	probably benign	Het
Tmem130	C	T	5: 144,755,427	G56R	possibly damaging	Het
Ttn	A	T	2: 76,723,750	W30870R	probably damaging	Het
Unc13b	A	T	4: 43,173,973	L1600F	unknown	Het
Vmn1r233	C	T	17: 20,994,155	V178M	probably damaging	Het
Vmn2r18	G	A	5: 151,562,061	P656L	probably damaging	Het
Vmn2r33	A	T	7: 7,563,863	D83E	probably benign	Het
Vps13b	G	A	15: 35,879,913	V3045I	probably benign	Het
Wdr25	A	T	12: 109,011,057		probably null	Het
Xpo6	A	G	7: 126,120,444	V591A	probably benign	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGGCAAGAGTTTAGCTGGAG -3'
(R):5'- TCCAAAGCTGGTACAAATGTTC -3'

Sequencing Primer
(F):5'- GAGCCACAGATAGCAGAGTCTC -3'
(R):5'- GCTGGTACAAATGTTCAATTTCG -3'

Posted On

2020-09-15