Incidental Mutation 'R7984:Dock7'
ID651358
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98989066 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1078 (N1078K)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127946] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: N1078K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: N1078K

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: N1048K

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: N1078K
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: N1078K

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127946
SMART Domains Protein: ENSMUSP00000119103
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150254
SMART Domains Protein: ENSMUSP00000114204
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205650
AA Change: N1048K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,595,680 H226N probably damaging Het
Aldh1a7 T C 19: 20,709,400 D283G probably damaging Het
Angel1 T C 12: 86,720,294 D436G probably benign Het
Ank1 G A 8: 23,088,966 R314Q probably damaging Het
Apbb2 T C 5: 66,307,692 E629G probably damaging Het
Card9 T G 2: 26,356,772 I355L probably benign Het
Cdon C T 9: 35,503,302 P1158S probably benign Het
Cpne7 T G 8: 123,119,722 V91G possibly damaging Het
Dlc1 T A 8: 36,938,318 T106S possibly damaging Het
Dnah1 A T 14: 31,267,815 F3248Y probably damaging Het
Dnah7a A T 1: 53,504,218 D2264E probably benign Het
Emc1 T A 4: 139,375,449 L973H probably damaging Het
Fer1l5 T A 1: 36,408,621 L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,113,409 N273S probably benign Het
Gle1 T A 2: 29,938,576 Y137N probably damaging Het
Grik4 G A 9: 42,671,261 Q130* probably null Het
Hcn1 C T 13: 117,976,073 Q858* probably null Het
Heg1 A C 16: 33,763,575 S76R possibly damaging Het
Ikbke T A 1: 131,275,786 E50V probably null Het
Itga5 G A 15: 103,355,952 P297S probably damaging Het
Kcng1 C A 2: 168,262,486 R480L possibly damaging Het
Kdm3b G T 18: 34,823,699 E1236* probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrp5 A G 19: 3,612,342 F894L probably damaging Het
Man2a2 T G 7: 80,353,308 T1018P probably damaging Het
Mctp2 T C 7: 72,103,189 Q772R possibly damaging Het
Meioc T A 11: 102,674,606 N293K possibly damaging Het
Mrps24 A T 11: 5,707,495 C34S possibly damaging Het
Nek1 G T 8: 61,121,053 E1112* probably null Het
Nt5dc2 A G 14: 31,138,818 S317G probably damaging Het
Obscn G T 11: 59,106,325 Q1492K possibly damaging Het
Olfr1160 T A 2: 88,006,625 N42I probably damaging Het
Olfr1413 A G 1: 92,573,422 I84V probably benign Het
Olfr47 T G 6: 43,235,796 S63A probably damaging Het
Olfr677 T C 7: 105,056,432 F62S probably damaging Het
Olfr816 A G 10: 129,912,072 F69L probably benign Het
Olfr883 A G 9: 38,025,859 T18A probably damaging Het
P2ry12 T A 3: 59,217,601 I218F probably damaging Het
Paip1 C T 13: 119,430,162 Q11* probably null Het
Pcdhga3 C A 18: 37,676,496 D667E probably benign Het
Pcnx2 T G 8: 125,759,126 E1911A probably benign Het
Pibf1 T C 14: 99,221,627 L678P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prl2c1 G A 13: 27,855,327 probably null Het
Rnf112 A G 11: 61,449,480 V656A possibly damaging Het
Slc24a1 A T 9: 64,949,529 L32* probably null Het
Slc7a1 A G 5: 148,342,110 V284A possibly damaging Het
Slco5a1 T A 1: 12,881,384 H565L probably damaging Het
Sulf1 A G 1: 12,859,273 T255A probably benign Het
Tmem130 C T 5: 144,755,427 G56R possibly damaging Het
Trmt1l A C 1: 151,435,738 Q116H probably benign Het
Ttn A T 2: 76,723,750 W30870R probably damaging Het
Unc13b A T 4: 43,173,973 L1600F unknown Het
Vmn1r233 C T 17: 20,994,155 V178M probably damaging Het
Vmn2r18 G A 5: 151,562,061 P656L probably damaging Het
Vmn2r33 A T 7: 7,563,863 D83E probably benign Het
Vps13b G A 15: 35,879,913 V3045I probably benign Het
Xpo6 A G 7: 126,120,444 V591A probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
R7928:Dock7 UTSW 4 99001098 missense
R8287:Dock7 UTSW 4 98977920 missense unknown
R8439:Dock7 UTSW 4 99083029 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTCCACCACAGTGTTAACAAC -3'
(R):5'- TATTGCTGCCCTGGTTAGCAC -3'

Sequencing Primer
(F):5'- TGTTAACAACACAGGACTCGG -3'
(R):5'- CACAATTGCTGGCGATGTC -3'
Posted On2020-09-15