Incidental Mutation 'R7984:Emc1'
ID 651359
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 046025-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7984 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139102760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 973 (L973H)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: L970H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: L970H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: L973H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: L973H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably damaging
Transcript: ENSMUST00000179784
AA Change: L973H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: L973H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.5830 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,645,679 (GRCm39) H226N probably damaging Het
Aldh1a7 T C 19: 20,686,764 (GRCm39) D283G probably damaging Het
Angel1 T C 12: 86,767,068 (GRCm39) D436G probably benign Het
Ank1 G A 8: 23,578,982 (GRCm39) R314Q probably damaging Het
Apbb2 T C 5: 66,465,035 (GRCm39) E629G probably damaging Het
Card9 T G 2: 26,246,784 (GRCm39) I355L probably benign Het
Cdon C T 9: 35,414,598 (GRCm39) P1158S probably benign Het
Cpne7 T G 8: 123,846,461 (GRCm39) V91G possibly damaging Het
Dlc1 T A 8: 37,405,472 (GRCm39) T106S possibly damaging Het
Dnah1 A T 14: 30,989,772 (GRCm39) F3248Y probably damaging Het
Dnah7a A T 1: 53,543,377 (GRCm39) D2264E probably benign Het
Dock7 A T 4: 98,877,303 (GRCm39) N1078K unknown Het
Fer1l5 T A 1: 36,447,702 (GRCm39) L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,333,671 (GRCm39) N273S probably benign Het
Gle1 T A 2: 29,828,588 (GRCm39) Y137N probably damaging Het
Grik4 G A 9: 42,582,557 (GRCm39) Q130* probably null Het
Hcn1 C T 13: 118,112,609 (GRCm39) Q858* probably null Het
Heg1 A C 16: 33,583,945 (GRCm39) S76R possibly damaging Het
Ikbke T A 1: 131,203,523 (GRCm39) E50V probably null Het
Itga5 G A 15: 103,264,379 (GRCm39) P297S probably damaging Het
Kcng1 C A 2: 168,104,406 (GRCm39) R480L possibly damaging Het
Kdm3b G T 18: 34,956,752 (GRCm39) E1236* probably null Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lrp5 A G 19: 3,662,342 (GRCm39) F894L probably damaging Het
Lrrk1 T C 7: 65,950,477 (GRCm39) probably null Het
Man2a2 T G 7: 80,003,056 (GRCm39) T1018P probably damaging Het
Mctp2 T C 7: 71,752,937 (GRCm39) Q772R possibly damaging Het
Meioc T A 11: 102,565,432 (GRCm39) N293K possibly damaging Het
Mrps24 A T 11: 5,657,495 (GRCm39) C34S possibly damaging Het
Nek1 G T 8: 61,574,087 (GRCm39) E1112* probably null Het
Nt5dc2 A G 14: 30,860,775 (GRCm39) S317G probably damaging Het
Obscn G T 11: 58,997,151 (GRCm39) Q1492K possibly damaging Het
Or2a57 T G 6: 43,212,730 (GRCm39) S63A probably damaging Het
Or52e4 T C 7: 104,705,639 (GRCm39) F62S probably damaging Het
Or6c69 A G 10: 129,747,941 (GRCm39) F69L probably benign Het
Or8b36 A G 9: 37,937,155 (GRCm39) T18A probably damaging Het
Or9m1b T A 2: 87,836,969 (GRCm39) N42I probably damaging Het
Or9s23 A G 1: 92,501,144 (GRCm39) I84V probably benign Het
P2ry12 T A 3: 59,125,022 (GRCm39) I218F probably damaging Het
Paip1 C T 13: 119,566,698 (GRCm39) Q11* probably null Het
Pcdhga3 C A 18: 37,809,549 (GRCm39) D667E probably benign Het
Pcnx2 T G 8: 126,485,865 (GRCm39) E1911A probably benign Het
Pibf1 T C 14: 99,459,063 (GRCm39) L678P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Prickle2 T C 6: 92,387,855 (GRCm39) T516A probably benign Het
Prl2c1 G A 13: 28,039,310 (GRCm39) probably null Het
Rnf112 A G 11: 61,340,306 (GRCm39) V656A possibly damaging Het
Siglecf A C 7: 43,004,655 (GRCm39) probably null Het
Slc24a1 A T 9: 64,856,811 (GRCm39) L32* probably null Het
Slc7a1 A G 5: 148,278,920 (GRCm39) V284A possibly damaging Het
Slco5a1 T A 1: 12,951,608 (GRCm39) H565L probably damaging Het
Slit2 A G 5: 48,333,465 (GRCm39) probably benign Het
Sulf1 A G 1: 12,929,497 (GRCm39) T255A probably benign Het
Tmem130 C T 5: 144,692,237 (GRCm39) G56R possibly damaging Het
Trmt1l A C 1: 151,311,489 (GRCm39) Q116H probably benign Het
Ttn A T 2: 76,554,094 (GRCm39) W30870R probably damaging Het
Unc13b A T 4: 43,173,973 (GRCm39) L1600F unknown Het
Vmn1r233 C T 17: 21,214,417 (GRCm39) V178M probably damaging Het
Vmn2r18 G A 5: 151,485,526 (GRCm39) P656L probably damaging Het
Vmn2r33 A T 7: 7,566,862 (GRCm39) D83E probably benign Het
Vps13b G A 15: 35,880,059 (GRCm39) V3045I probably benign Het
Wdr25 A T 12: 108,976,983 (GRCm39) probably null Het
Xpo6 A G 7: 125,719,616 (GRCm39) V591A probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTCCTGACTGAATCTGAGGTG -3'
(R):5'- TCCCGAAGCACTTCTCCATG -3'

Sequencing Primer
(F):5'- AGGTGCTGTGGCTGCTCAC -3'
(R):5'- TTCTCCATGAAGGTGCACC -3'
Posted On 2020-09-15