Incidental Mutation 'R7984:Emc1'
ID651359
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7984 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139375449 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 973 (L973H)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: L970H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: L970H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: L973H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: L973H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably damaging
Transcript: ENSMUST00000179784
AA Change: L973H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: L973H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.5830 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,595,680 H226N probably damaging Het
Aldh1a7 T C 19: 20,709,400 D283G probably damaging Het
Angel1 T C 12: 86,720,294 D436G probably benign Het
Ank1 G A 8: 23,088,966 R314Q probably damaging Het
Apbb2 T C 5: 66,307,692 E629G probably damaging Het
Card9 T G 2: 26,356,772 I355L probably benign Het
Cdon C T 9: 35,503,302 P1158S probably benign Het
Cpne7 T G 8: 123,119,722 V91G possibly damaging Het
Dlc1 T A 8: 36,938,318 T106S possibly damaging Het
Dnah1 A T 14: 31,267,815 F3248Y probably damaging Het
Dnah7a A T 1: 53,504,218 D2264E probably benign Het
Dock7 A T 4: 98,989,066 N1078K unknown Het
Fer1l5 T A 1: 36,408,621 L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,113,409 N273S probably benign Het
Gle1 T A 2: 29,938,576 Y137N probably damaging Het
Grik4 G A 9: 42,671,261 Q130* probably null Het
Hcn1 C T 13: 117,976,073 Q858* probably null Het
Heg1 A C 16: 33,763,575 S76R possibly damaging Het
Ikbke T A 1: 131,275,786 E50V probably null Het
Itga5 G A 15: 103,355,952 P297S probably damaging Het
Kcng1 C A 2: 168,262,486 R480L possibly damaging Het
Kdm3b G T 18: 34,823,699 E1236* probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrp5 A G 19: 3,612,342 F894L probably damaging Het
Lrrk1 T C 7: 66,300,729 probably null Het
Man2a2 T G 7: 80,353,308 T1018P probably damaging Het
Mctp2 T C 7: 72,103,189 Q772R possibly damaging Het
Meioc T A 11: 102,674,606 N293K possibly damaging Het
Mrps24 A T 11: 5,707,495 C34S possibly damaging Het
Nek1 G T 8: 61,121,053 E1112* probably null Het
Nt5dc2 A G 14: 31,138,818 S317G probably damaging Het
Obscn G T 11: 59,106,325 Q1492K possibly damaging Het
Olfr1160 T A 2: 88,006,625 N42I probably damaging Het
Olfr1413 A G 1: 92,573,422 I84V probably benign Het
Olfr47 T G 6: 43,235,796 S63A probably damaging Het
Olfr677 T C 7: 105,056,432 F62S probably damaging Het
Olfr816 A G 10: 129,912,072 F69L probably benign Het
Olfr883 A G 9: 38,025,859 T18A probably damaging Het
P2ry12 T A 3: 59,217,601 I218F probably damaging Het
Paip1 C T 13: 119,430,162 Q11* probably null Het
Pcdhga3 C A 18: 37,676,496 D667E probably benign Het
Pcnx2 T G 8: 125,759,126 E1911A probably benign Het
Pibf1 T C 14: 99,221,627 L678P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prl2c1 G A 13: 27,855,327 probably null Het
Rnf112 A G 11: 61,449,480 V656A possibly damaging Het
Siglecf A C 7: 43,355,231 probably null Het
Slc24a1 A T 9: 64,949,529 L32* probably null Het
Slc7a1 A G 5: 148,342,110 V284A possibly damaging Het
Slco5a1 T A 1: 12,881,384 H565L probably damaging Het
Slit2 A G 5: 48,176,123 probably benign Het
Sulf1 A G 1: 12,859,273 T255A probably benign Het
Tmem130 C T 5: 144,755,427 G56R possibly damaging Het
Trmt1l A C 1: 151,435,738 Q116H probably benign Het
Ttn A T 2: 76,723,750 W30870R probably damaging Het
Unc13b A T 4: 43,173,973 L1600F unknown Het
Vmn1r233 C T 17: 20,994,155 V178M probably damaging Het
Vmn2r18 G A 5: 151,562,061 P656L probably damaging Het
Vmn2r33 A T 7: 7,563,863 D83E probably benign Het
Vps13b G A 15: 35,879,913 V3045I probably benign Het
Wdr25 A T 12: 109,011,057 probably null Het
Xpo6 A G 7: 126,120,444 V591A probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCCTGACTGAATCTGAGGTG -3'
(R):5'- TCCCGAAGCACTTCTCCATG -3'

Sequencing Primer
(F):5'- AGGTGCTGTGGCTGCTCAC -3'
(R):5'- TTCTCCATGAAGGTGCACC -3'
Posted On2020-09-15