Incidental Mutation 'R7984:Vmn2r33'
ID651367
Institutional Source Beutler Lab
Gene Symbol Vmn2r33
Ensembl Gene ENSMUSG00000096691
Gene Namevomeronasal 2, receptor 33
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7984 (G1)
Quality Score132.008
Status Not validated
Chromosome7
Chromosomal Location7550967-7566786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7563863 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 83 (D83E)
Ref Sequence ENSEMBL: ENSMUSP00000129960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165921]
Predicted Effect probably benign
Transcript: ENSMUST00000165921
AA Change: D83E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129960
Gene: ENSMUSG00000096691
AA Change: D83E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.2e-34 PFAM
Pfam:NCD3G 512 565 4.1e-19 PFAM
Pfam:7tm_3 598 833 3.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,595,680 H226N probably damaging Het
Aldh1a7 T C 19: 20,709,400 D283G probably damaging Het
Angel1 T C 12: 86,720,294 D436G probably benign Het
Ank1 G A 8: 23,088,966 R314Q probably damaging Het
Apbb2 T C 5: 66,307,692 E629G probably damaging Het
Card9 T G 2: 26,356,772 I355L probably benign Het
Cdon C T 9: 35,503,302 P1158S probably benign Het
Cpne7 T G 8: 123,119,722 V91G possibly damaging Het
Dlc1 T A 8: 36,938,318 T106S possibly damaging Het
Dnah1 A T 14: 31,267,815 F3248Y probably damaging Het
Dnah7a A T 1: 53,504,218 D2264E probably benign Het
Dock7 A T 4: 98,989,066 N1078K unknown Het
Emc1 T A 4: 139,375,449 L973H probably damaging Het
Fer1l5 T A 1: 36,408,621 L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,113,409 N273S probably benign Het
Gle1 T A 2: 29,938,576 Y137N probably damaging Het
Grik4 G A 9: 42,671,261 Q130* probably null Het
Hcn1 C T 13: 117,976,073 Q858* probably null Het
Heg1 A C 16: 33,763,575 S76R possibly damaging Het
Ikbke T A 1: 131,275,786 E50V probably null Het
Itga5 G A 15: 103,355,952 P297S probably damaging Het
Kcng1 C A 2: 168,262,486 R480L possibly damaging Het
Kdm3b G T 18: 34,823,699 E1236* probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrp5 A G 19: 3,612,342 F894L probably damaging Het
Lrrk1 T C 7: 66,300,729 probably null Het
Man2a2 T G 7: 80,353,308 T1018P probably damaging Het
Mctp2 T C 7: 72,103,189 Q772R possibly damaging Het
Meioc T A 11: 102,674,606 N293K possibly damaging Het
Mrps24 A T 11: 5,707,495 C34S possibly damaging Het
Nek1 G T 8: 61,121,053 E1112* probably null Het
Nt5dc2 A G 14: 31,138,818 S317G probably damaging Het
Obscn G T 11: 59,106,325 Q1492K possibly damaging Het
Olfr1160 T A 2: 88,006,625 N42I probably damaging Het
Olfr1413 A G 1: 92,573,422 I84V probably benign Het
Olfr47 T G 6: 43,235,796 S63A probably damaging Het
Olfr677 T C 7: 105,056,432 F62S probably damaging Het
Olfr816 A G 10: 129,912,072 F69L probably benign Het
Olfr883 A G 9: 38,025,859 T18A probably damaging Het
P2ry12 T A 3: 59,217,601 I218F probably damaging Het
Paip1 C T 13: 119,430,162 Q11* probably null Het
Pcdhga3 C A 18: 37,676,496 D667E probably benign Het
Pcnx2 T G 8: 125,759,126 E1911A probably benign Het
Pibf1 T C 14: 99,221,627 L678P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prl2c1 G A 13: 27,855,327 probably null Het
Rnf112 A G 11: 61,449,480 V656A possibly damaging Het
Siglecf A C 7: 43,355,231 probably null Het
Slc24a1 A T 9: 64,949,529 L32* probably null Het
Slc7a1 A G 5: 148,342,110 V284A possibly damaging Het
Slco5a1 T A 1: 12,881,384 H565L probably damaging Het
Slit2 A G 5: 48,176,123 probably benign Het
Sulf1 A G 1: 12,859,273 T255A probably benign Het
Tmem130 C T 5: 144,755,427 G56R possibly damaging Het
Trmt1l A C 1: 151,435,738 Q116H probably benign Het
Ttn A T 2: 76,723,750 W30870R probably damaging Het
Unc13b A T 4: 43,173,973 L1600F unknown Het
Vmn1r233 C T 17: 20,994,155 V178M probably damaging Het
Vmn2r18 G A 5: 151,562,061 P656L probably damaging Het
Vps13b G A 15: 35,879,913 V3045I probably benign Het
Wdr25 A T 12: 109,011,057 probably null Het
Xpo6 A G 7: 126,120,444 V591A probably benign Het
Other mutations in Vmn2r33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Vmn2r33 APN 7 7563777 missense probably benign
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R1147:Vmn2r33 UTSW 7 7554145 missense probably benign 0.16
R3966:Vmn2r33 UTSW 7 7554169 missense probably benign 0.00
R4408:Vmn2r33 UTSW 7 7551230 missense probably damaging 1.00
R6571:Vmn2r33 UTSW 7 7563669 missense probably benign 0.00
R6783:Vmn2r33 UTSW 7 7563798 missense probably benign
R7180:Vmn2r33 UTSW 7 7563897 missense probably benign 0.00
R8202:Vmn2r33 UTSW 7 7554154 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTGTCCAGGTACTTCCAGAAAC -3'
(R):5'- CAGGTTCTCATGTCAATTCAATCTC -3'

Sequencing Primer
(F):5'- GTCCAGGTACTTCCAGAAACTTATAG -3'
(R):5'- TCTCATGTCAATTCAATCTCACAAC -3'
Posted On2020-09-15