Incidental Mutation 'R7984:Man2a2'
ID 651369
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock # R7984 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 80353308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1018 (T1018P)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206089] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: T1018P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: T1018P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,595,680 H226N probably damaging Het
Aldh1a7 T C 19: 20,709,400 D283G probably damaging Het
Angel1 T C 12: 86,720,294 D436G probably benign Het
Ank1 G A 8: 23,088,966 R314Q probably damaging Het
Apbb2 T C 5: 66,307,692 E629G probably damaging Het
Card9 T G 2: 26,356,772 I355L probably benign Het
Cdon C T 9: 35,503,302 P1158S probably benign Het
Cpne7 T G 8: 123,119,722 V91G possibly damaging Het
Dlc1 T A 8: 36,938,318 T106S possibly damaging Het
Dnah1 A T 14: 31,267,815 F3248Y probably damaging Het
Dnah7a A T 1: 53,504,218 D2264E probably benign Het
Dock7 A T 4: 98,989,066 N1078K unknown Het
Emc1 T A 4: 139,375,449 L973H probably damaging Het
Fer1l5 T A 1: 36,408,621 L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,113,409 N273S probably benign Het
Gle1 T A 2: 29,938,576 Y137N probably damaging Het
Grik4 G A 9: 42,671,261 Q130* probably null Het
Hcn1 C T 13: 117,976,073 Q858* probably null Het
Heg1 A C 16: 33,763,575 S76R possibly damaging Het
Ikbke T A 1: 131,275,786 E50V probably null Het
Itga5 G A 15: 103,355,952 P297S probably damaging Het
Kcng1 C A 2: 168,262,486 R480L possibly damaging Het
Kdm3b G T 18: 34,823,699 E1236* probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrp5 A G 19: 3,612,342 F894L probably damaging Het
Lrrk1 T C 7: 66,300,729 probably null Het
Mctp2 T C 7: 72,103,189 Q772R possibly damaging Het
Meioc T A 11: 102,674,606 N293K possibly damaging Het
Mrps24 A T 11: 5,707,495 C34S possibly damaging Het
Nek1 G T 8: 61,121,053 E1112* probably null Het
Nt5dc2 A G 14: 31,138,818 S317G probably damaging Het
Obscn G T 11: 59,106,325 Q1492K possibly damaging Het
Olfr1160 T A 2: 88,006,625 N42I probably damaging Het
Olfr1413 A G 1: 92,573,422 I84V probably benign Het
Olfr47 T G 6: 43,235,796 S63A probably damaging Het
Olfr677 T C 7: 105,056,432 F62S probably damaging Het
Olfr816 A G 10: 129,912,072 F69L probably benign Het
Olfr883 A G 9: 38,025,859 T18A probably damaging Het
P2ry12 T A 3: 59,217,601 I218F probably damaging Het
Paip1 C T 13: 119,430,162 Q11* probably null Het
Pcdhga3 C A 18: 37,676,496 D667E probably benign Het
Pcnx2 T G 8: 125,759,126 E1911A probably benign Het
Pibf1 T C 14: 99,221,627 L678P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prl2c1 G A 13: 27,855,327 probably null Het
Rnf112 A G 11: 61,449,480 V656A possibly damaging Het
Siglecf A C 7: 43,355,231 probably null Het
Slc24a1 A T 9: 64,949,529 L32* probably null Het
Slc7a1 A G 5: 148,342,110 V284A possibly damaging Het
Slco5a1 T A 1: 12,881,384 H565L probably damaging Het
Slit2 A G 5: 48,176,123 probably benign Het
Sulf1 A G 1: 12,859,273 T255A probably benign Het
Tmem130 C T 5: 144,755,427 G56R possibly damaging Het
Trmt1l A C 1: 151,435,738 Q116H probably benign Het
Ttn A T 2: 76,723,750 W30870R probably damaging Het
Unc13b A T 4: 43,173,973 L1600F unknown Het
Vmn1r233 C T 17: 20,994,155 V178M probably damaging Het
Vmn2r18 G A 5: 151,562,061 P656L probably damaging Het
Vmn2r33 A T 7: 7,563,863 D83E probably benign Het
Vps13b G A 15: 35,879,913 V3045I probably benign Het
Wdr25 A T 12: 109,011,057 probably null Het
Xpo6 A G 7: 126,120,444 V591A probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80361120 missense probably benign
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCACTGACTGGGACACTCAC -3'
(R):5'- TCACCTGACTGTCTGTGAGC -3'

Sequencing Primer
(F):5'- ACTGGGACACTCACCTCGG -3'
(R):5'- CATAGTTAGTAGCCACCTCTGAGG -3'
Posted On 2020-09-15