Mutagenetix > Incidental Mutation

Incidental Mutation 'R7984:Rnf112'

651384

Institutional Source

Beutler Lab

Gene Symbol

Rnf112

Ensembl Gene

ENSMUSG00000010086

Gene Name

ring finger protein 112

Synonyms

Zfp179, bfp

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7984 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

61448442-61454131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61449480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 656 (V656A)

Ref Sequence

ENSEMBL: ENSMUSP00000059903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]

AlphaFold

Q96DY5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054927
AA Change: V631A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: V631A

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	423	1.3e-21	PFAM
low complexity region	541	557	N/A	INTRINSIC
transmembrane domain	570	592	N/A	INTRINSIC
transmembrane domain	605	627	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060255
AA Change: V656A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: V656A

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	448	2.8e-21	PFAM
low complexity region	566	582	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
transmembrane domain	630	652	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102661
AA Change: V608A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: V608A

Domain	Start	End	E-Value	Type
RING	57	97	1.7e-7	SMART
low complexity region	116	127	N/A	INTRINSIC
Pfam:GBP	148	400	2.7e-19	PFAM
low complexity region	518	534	N/A	INTRINSIC
transmembrane domain	547	569	N/A	INTRINSIC
transmembrane domain	582	604	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1e1	G	T	13: 4,595,680	H226N	probably damaging	Het
Aldh1a7	T	C	19: 20,709,400	D283G	probably damaging	Het
Angel1	T	C	12: 86,720,294	D436G	probably benign	Het
Ank1	G	A	8: 23,088,966	R314Q	probably damaging	Het
Apbb2	T	C	5: 66,307,692	E629G	probably damaging	Het
Card9	T	G	2: 26,356,772	I355L	probably benign	Het
Cdon	C	T	9: 35,503,302	P1158S	probably benign	Het
Cpne7	T	G	8: 123,119,722	V91G	possibly damaging	Het
Dlc1	T	A	8: 36,938,318	T106S	possibly damaging	Het
Dnah1	A	T	14: 31,267,815	F3248Y	probably damaging	Het
Dnah7a	A	T	1: 53,504,218	D2264E	probably benign	Het
Dock7	A	T	4: 98,989,066	N1078K	unknown	Het
Emc1	T	A	4: 139,375,449	L973H	probably damaging	Het
Fer1l5	T	A	1: 36,408,621	L955Q	possibly damaging	Het
Fpr-rs7	T	C	17: 20,113,409	N273S	probably benign	Het
Gle1	T	A	2: 29,938,576	Y137N	probably damaging	Het
Grik4	G	A	9: 42,671,261	Q130*	probably null	Het
Hcn1	C	T	13: 117,976,073	Q858*	probably null	Het
Heg1	A	C	16: 33,763,575	S76R	possibly damaging	Het
Ikbke	T	A	1: 131,275,786	E50V	probably null	Het
Itga5	G	A	15: 103,355,952	P297S	probably damaging	Het
Kcng1	C	A	2: 168,262,486	R480L	possibly damaging	Het
Kdm3b	G	T	18: 34,823,699	E1236*	probably null	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Lrp5	A	G	19: 3,612,342	F894L	probably damaging	Het
Lrrk1	T	C	7: 66,300,729		probably null	Het
Man2a2	T	G	7: 80,353,308	T1018P	probably damaging	Het
Mctp2	T	C	7: 72,103,189	Q772R	possibly damaging	Het
Meioc	T	A	11: 102,674,606	N293K	possibly damaging	Het
Mrps24	A	T	11: 5,707,495	C34S	possibly damaging	Het
Nek1	G	T	8: 61,121,053	E1112*	probably null	Het
Nt5dc2	A	G	14: 31,138,818	S317G	probably damaging	Het
Obscn	G	T	11: 59,106,325	Q1492K	possibly damaging	Het
Olfr1160	T	A	2: 88,006,625	N42I	probably damaging	Het
Olfr1413	A	G	1: 92,573,422	I84V	probably benign	Het
Olfr47	T	G	6: 43,235,796	S63A	probably damaging	Het
Olfr677	T	C	7: 105,056,432	F62S	probably damaging	Het
Olfr816	A	G	10: 129,912,072	F69L	probably benign	Het
Olfr883	A	G	9: 38,025,859	T18A	probably damaging	Het
P2ry12	T	A	3: 59,217,601	I218F	probably damaging	Het
Paip1	C	T	13: 119,430,162	Q11*	probably null	Het
Pcdhga3	C	A	18: 37,676,496	D667E	probably benign	Het
Pcnx2	T	G	8: 125,759,126	E1911A	probably benign	Het
Pibf1	T	C	14: 99,221,627	L678P	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Prickle2	T	C	6: 92,410,874	T516A	probably benign	Het
Prl2c1	G	A	13: 27,855,327		probably null	Het
Siglecf	A	C	7: 43,355,231		probably null	Het
Slc24a1	A	T	9: 64,949,529	L32*	probably null	Het
Slc7a1	A	G	5: 148,342,110	V284A	possibly damaging	Het
Slco5a1	T	A	1: 12,881,384	H565L	probably damaging	Het
Slit2	A	G	5: 48,176,123		probably benign	Het
Sulf1	A	G	1: 12,859,273	T255A	probably benign	Het
Tmem130	C	T	5: 144,755,427	G56R	possibly damaging	Het
Trmt1l	A	C	1: 151,435,738	Q116H	probably benign	Het
Ttn	A	T	2: 76,723,750	W30870R	probably damaging	Het
Unc13b	A	T	4: 43,173,973	L1600F	unknown	Het
Vmn1r233	C	T	17: 20,994,155	V178M	probably damaging	Het
Vmn2r18	G	A	5: 151,562,061	P656L	probably damaging	Het
Vmn2r33	A	T	7: 7,563,863	D83E	probably benign	Het
Vps13b	G	A	15: 35,879,913	V3045I	probably benign	Het
Wdr25	A	T	12: 109,011,057		probably null	Het
Xpo6	A	G	7: 126,120,444	V591A	probably benign	Het

Other mutations in Rnf112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Rnf112	APN	11	61452784	missense	probably damaging	1.00
IGL01339:Rnf112	APN	11	61450477	missense	probably benign	0.00
IGL01469:Rnf112	APN	11	61451341	missense	possibly damaging	0.94
IGL02102:Rnf112	APN	11	61452015	missense	probably benign	0.36
IGL02216:Rnf112	APN	11	61449978	missense	probably damaging	1.00
IGL02431:Rnf112	APN	11	61450379	missense	probably benign	0.17
IGL02638:Rnf112	APN	11	61449405	utr 3 prime	probably benign
IGL02657:Rnf112	APN	11	61450252	splice site	probably null
R0041:Rnf112	UTSW	11	61452355	missense	probably damaging	1.00
R1514:Rnf112	UTSW	11	61450410	missense	probably benign	0.01
R1991:Rnf112	UTSW	11	61452426	missense	probably damaging	1.00
R2119:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R2216:Rnf112	UTSW	11	61452279	missense	probably damaging	1.00
R2880:Rnf112	UTSW	11	61450467	missense	possibly damaging	0.89
R3775:Rnf112	UTSW	11	61450185	splice site	probably benign
R3904:Rnf112	UTSW	11	61450385	missense	probably damaging	1.00
R4646:Rnf112	UTSW	11	61452110	missense	probably damaging	0.99
R4710:Rnf112	UTSW	11	61449831	missense	probably damaging	1.00
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4894:Rnf112	UTSW	11	61452662	missense	probably damaging	1.00
R4930:Rnf112	UTSW	11	61453465	missense	probably benign
R4967:Rnf112	UTSW	11	61452926	splice site	probably benign
R4992:Rnf112	UTSW	11	61452711	missense	possibly damaging	0.72
R5547:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R5874:Rnf112	UTSW	11	61449447	missense	probably damaging	0.98
R5997:Rnf112	UTSW	11	61451022	missense	possibly damaging	0.87
R6023:Rnf112	UTSW	11	61449729	missense	probably damaging	1.00
R6906:Rnf112	UTSW	11	61450389	missense	probably null	0.38
R7194:Rnf112	UTSW	11	61450857	missense	probably damaging	1.00
R7439:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R8984:Rnf112	UTSW	11	61452451	missense	possibly damaging	0.90
R9756:Rnf112	UTSW	11	61449841	missense	probably damaging	1.00
Z1177:Rnf112	UTSW	11	61449679	missense	probably damaging	1.00
Z1186:Rnf112	UTSW	11	61450949	missense	unknown
Z1187:Rnf112	UTSW	11	61450949	missense	unknown
Z1188:Rnf112	UTSW	11	61450949	missense	unknown
Z1189:Rnf112	UTSW	11	61450949	missense	unknown
Z1190:Rnf112	UTSW	11	61450949	missense	unknown
Z1191:Rnf112	UTSW	11	61450949	missense	unknown
Z1192:Rnf112	UTSW	11	61450949	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTTTGACATGGGGCATTCAAC -3'
(R):5'- GACTCCTACACAATGCGCTTC -3'

Sequencing Primer
(F):5'- CAAGGCCAGTATATACGTGGTCC -3'
(R):5'- ACACAATGCGCTTCTGTGG -3'

Posted On

2020-09-15