Incidental Mutation 'R7984:Meioc'
ID 651385
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R7984 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102674606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 293 (N293K)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect possibly damaging
Transcript: ENSMUST00000100378
AA Change: N349K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: N349K

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156590
AA Change: N293K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: N293K

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,595,680 H226N probably damaging Het
Aldh1a7 T C 19: 20,709,400 D283G probably damaging Het
Angel1 T C 12: 86,720,294 D436G probably benign Het
Ank1 G A 8: 23,088,966 R314Q probably damaging Het
Apbb2 T C 5: 66,307,692 E629G probably damaging Het
Card9 T G 2: 26,356,772 I355L probably benign Het
Cdon C T 9: 35,503,302 P1158S probably benign Het
Cpne7 T G 8: 123,119,722 V91G possibly damaging Het
Dlc1 T A 8: 36,938,318 T106S possibly damaging Het
Dnah1 A T 14: 31,267,815 F3248Y probably damaging Het
Dnah7a A T 1: 53,504,218 D2264E probably benign Het
Dock7 A T 4: 98,989,066 N1078K unknown Het
Emc1 T A 4: 139,375,449 L973H probably damaging Het
Fer1l5 T A 1: 36,408,621 L955Q possibly damaging Het
Fpr-rs7 T C 17: 20,113,409 N273S probably benign Het
Gle1 T A 2: 29,938,576 Y137N probably damaging Het
Grik4 G A 9: 42,671,261 Q130* probably null Het
Hcn1 C T 13: 117,976,073 Q858* probably null Het
Heg1 A C 16: 33,763,575 S76R possibly damaging Het
Ikbke T A 1: 131,275,786 E50V probably null Het
Itga5 G A 15: 103,355,952 P297S probably damaging Het
Kcng1 C A 2: 168,262,486 R480L possibly damaging Het
Kdm3b G T 18: 34,823,699 E1236* probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrp5 A G 19: 3,612,342 F894L probably damaging Het
Lrrk1 T C 7: 66,300,729 probably null Het
Man2a2 T G 7: 80,353,308 T1018P probably damaging Het
Mctp2 T C 7: 72,103,189 Q772R possibly damaging Het
Mrps24 A T 11: 5,707,495 C34S possibly damaging Het
Nek1 G T 8: 61,121,053 E1112* probably null Het
Nt5dc2 A G 14: 31,138,818 S317G probably damaging Het
Obscn G T 11: 59,106,325 Q1492K possibly damaging Het
Olfr1160 T A 2: 88,006,625 N42I probably damaging Het
Olfr1413 A G 1: 92,573,422 I84V probably benign Het
Olfr47 T G 6: 43,235,796 S63A probably damaging Het
Olfr677 T C 7: 105,056,432 F62S probably damaging Het
Olfr816 A G 10: 129,912,072 F69L probably benign Het
Olfr883 A G 9: 38,025,859 T18A probably damaging Het
P2ry12 T A 3: 59,217,601 I218F probably damaging Het
Paip1 C T 13: 119,430,162 Q11* probably null Het
Pcdhga3 C A 18: 37,676,496 D667E probably benign Het
Pcnx2 T G 8: 125,759,126 E1911A probably benign Het
Pibf1 T C 14: 99,221,627 L678P probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prl2c1 G A 13: 27,855,327 probably null Het
Rnf112 A G 11: 61,449,480 V656A possibly damaging Het
Siglecf A C 7: 43,355,231 probably null Het
Slc24a1 A T 9: 64,949,529 L32* probably null Het
Slc7a1 A G 5: 148,342,110 V284A possibly damaging Het
Slco5a1 T A 1: 12,881,384 H565L probably damaging Het
Slit2 A G 5: 48,176,123 probably benign Het
Sulf1 A G 1: 12,859,273 T255A probably benign Het
Tmem130 C T 5: 144,755,427 G56R possibly damaging Het
Trmt1l A C 1: 151,435,738 Q116H probably benign Het
Ttn A T 2: 76,723,750 W30870R probably damaging Het
Unc13b A T 4: 43,173,973 L1600F unknown Het
Vmn1r233 C T 17: 20,994,155 V178M probably damaging Het
Vmn2r18 G A 5: 151,562,061 P656L probably damaging Het
Vmn2r33 A T 7: 7,563,863 D83E probably benign Het
Vps13b G A 15: 35,879,913 V3045I probably benign Het
Wdr25 A T 12: 109,011,057 probably null Het
Xpo6 A G 7: 126,120,444 V591A probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTGTCTGATATCATGAAAG -3'
(R):5'- GAATGCTGCTTCCTTTGCAAAC -3'

Sequencing Primer
(F):5'- CAGGAATTGATACTTATGCCTATGG -3'
(R):5'- GCAAACTGTTTTTCTGTCAGATG -3'
Posted On 2020-09-15