Incidental Mutation 'R7984:Fpr-rs7'
ID 651397
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 046025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7984 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20333671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 273 (N273S)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: N273S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: N273S

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1e1 G T 13: 4,645,679 (GRCm39) H226N probably damaging Het
Aldh1a7 T C 19: 20,686,764 (GRCm39) D283G probably damaging Het
Angel1 T C 12: 86,767,068 (GRCm39) D436G probably benign Het
Ank1 G A 8: 23,578,982 (GRCm39) R314Q probably damaging Het
Apbb2 T C 5: 66,465,035 (GRCm39) E629G probably damaging Het
Card9 T G 2: 26,246,784 (GRCm39) I355L probably benign Het
Cdon C T 9: 35,414,598 (GRCm39) P1158S probably benign Het
Cpne7 T G 8: 123,846,461 (GRCm39) V91G possibly damaging Het
Dlc1 T A 8: 37,405,472 (GRCm39) T106S possibly damaging Het
Dnah1 A T 14: 30,989,772 (GRCm39) F3248Y probably damaging Het
Dnah7a A T 1: 53,543,377 (GRCm39) D2264E probably benign Het
Dock7 A T 4: 98,877,303 (GRCm39) N1078K unknown Het
Emc1 T A 4: 139,102,760 (GRCm39) L973H probably damaging Het
Fer1l5 T A 1: 36,447,702 (GRCm39) L955Q possibly damaging Het
Gle1 T A 2: 29,828,588 (GRCm39) Y137N probably damaging Het
Grik4 G A 9: 42,582,557 (GRCm39) Q130* probably null Het
Hcn1 C T 13: 118,112,609 (GRCm39) Q858* probably null Het
Heg1 A C 16: 33,583,945 (GRCm39) S76R possibly damaging Het
Ikbke T A 1: 131,203,523 (GRCm39) E50V probably null Het
Itga5 G A 15: 103,264,379 (GRCm39) P297S probably damaging Het
Kcng1 C A 2: 168,104,406 (GRCm39) R480L possibly damaging Het
Kdm3b G T 18: 34,956,752 (GRCm39) E1236* probably null Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lrp5 A G 19: 3,662,342 (GRCm39) F894L probably damaging Het
Lrrk1 T C 7: 65,950,477 (GRCm39) probably null Het
Man2a2 T G 7: 80,003,056 (GRCm39) T1018P probably damaging Het
Mctp2 T C 7: 71,752,937 (GRCm39) Q772R possibly damaging Het
Meioc T A 11: 102,565,432 (GRCm39) N293K possibly damaging Het
Mrps24 A T 11: 5,657,495 (GRCm39) C34S possibly damaging Het
Nek1 G T 8: 61,574,087 (GRCm39) E1112* probably null Het
Nt5dc2 A G 14: 30,860,775 (GRCm39) S317G probably damaging Het
Obscn G T 11: 58,997,151 (GRCm39) Q1492K possibly damaging Het
Or2a57 T G 6: 43,212,730 (GRCm39) S63A probably damaging Het
Or52e4 T C 7: 104,705,639 (GRCm39) F62S probably damaging Het
Or6c69 A G 10: 129,747,941 (GRCm39) F69L probably benign Het
Or8b36 A G 9: 37,937,155 (GRCm39) T18A probably damaging Het
Or9m1b T A 2: 87,836,969 (GRCm39) N42I probably damaging Het
Or9s23 A G 1: 92,501,144 (GRCm39) I84V probably benign Het
P2ry12 T A 3: 59,125,022 (GRCm39) I218F probably damaging Het
Paip1 C T 13: 119,566,698 (GRCm39) Q11* probably null Het
Pcdhga3 C A 18: 37,809,549 (GRCm39) D667E probably benign Het
Pcnx2 T G 8: 126,485,865 (GRCm39) E1911A probably benign Het
Pibf1 T C 14: 99,459,063 (GRCm39) L678P probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Prickle2 T C 6: 92,387,855 (GRCm39) T516A probably benign Het
Prl2c1 G A 13: 28,039,310 (GRCm39) probably null Het
Rnf112 A G 11: 61,340,306 (GRCm39) V656A possibly damaging Het
Siglecf A C 7: 43,004,655 (GRCm39) probably null Het
Slc24a1 A T 9: 64,856,811 (GRCm39) L32* probably null Het
Slc7a1 A G 5: 148,278,920 (GRCm39) V284A possibly damaging Het
Slco5a1 T A 1: 12,951,608 (GRCm39) H565L probably damaging Het
Slit2 A G 5: 48,333,465 (GRCm39) probably benign Het
Sulf1 A G 1: 12,929,497 (GRCm39) T255A probably benign Het
Tmem130 C T 5: 144,692,237 (GRCm39) G56R possibly damaging Het
Trmt1l A C 1: 151,311,489 (GRCm39) Q116H probably benign Het
Ttn A T 2: 76,554,094 (GRCm39) W30870R probably damaging Het
Unc13b A T 4: 43,173,973 (GRCm39) L1600F unknown Het
Vmn1r233 C T 17: 21,214,417 (GRCm39) V178M probably damaging Het
Vmn2r18 G A 5: 151,485,526 (GRCm39) P656L probably damaging Het
Vmn2r33 A T 7: 7,566,862 (GRCm39) D83E probably benign Het
Vps13b G A 15: 35,880,059 (GRCm39) V3045I probably benign Het
Wdr25 A T 12: 108,976,983 (GRCm39) probably null Het
Xpo6 A G 7: 125,719,616 (GRCm39) V591A probably benign Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1439:Fpr-rs7 UTSW 17 20,333,869 (GRCm39) missense probably benign 0.10
R1590:Fpr-rs7 UTSW 17 20,333,678 (GRCm39) missense probably benign 0.05
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R5959:Fpr-rs7 UTSW 17 20,334,011 (GRCm39) missense probably benign 0.01
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7921:Fpr-rs7 UTSW 17 20,333,667 (GRCm39) missense probably benign 0.03
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8172:Fpr-rs7 UTSW 17 20,334,443 (GRCm39) missense probably benign 0.04
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCAGGTCCTATGTCTCAGAG -3'
(R):5'- TGTTGGCTTCAGCATACCAATG -3'

Sequencing Primer
(F):5'- CAGGTCCTATGTCTCAGAGTCTTAAG -3'
(R):5'- GGCTTCAGCATACCAATGATCTTC -3'
Posted On 2020-09-15