Incidental Mutation 'R7985:5830411N06Rik'
ID 651430
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7985 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140296893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 732 (D732E)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably damaging
Transcript: ENSMUST00000093984
AA Change: D616E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: D616E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164583
AA Change: D732E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: D732E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,664,349 S77R unknown Het
4933425L06Rik C T 13: 105,119,974 T517I probably benign Het
Adamts1 T C 16: 85,798,114 Y582C probably damaging Het
Ahnak2 A T 12: 112,778,963 V683E Het
Allc T G 12: 28,553,972 T371P probably damaging Het
Ankrd12 A G 17: 65,984,196 I1414T probably benign Het
Bahcc1 A G 11: 120,272,891 K672E probably damaging Het
C3ar1 A T 6: 122,850,005 S418T probably damaging Het
C530008M17Rik T C 5: 76,658,050 V123A unknown Het
Calca A G 7: 114,635,178 V12A possibly damaging Het
Carmil3 A G 14: 55,496,952 E410G probably benign Het
Cfh A G 1: 140,108,826 F680S probably damaging Het
Csf3 G A 11: 98,702,447 G130D probably damaging Het
Cuedc1 A T 11: 88,182,516 Q169L probably benign Het
Cyp2c66 T A 19: 39,113,986 W20R probably null Het
Dguok C T 6: 83,480,932 E240K probably damaging Het
Dlg1 T G 16: 31,788,105 Y220* probably null Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Dnaic1 T C 4: 41,630,055 I488T probably benign Het
Dock1 G T 7: 134,746,954 C299F possibly damaging Het
Ebi3 C T 17: 55,953,997 T59M probably benign Het
Esrp1 G A 4: 11,367,153 S160F probably benign Het
Evi5l A G 8: 4,203,536 D471G probably benign Het
Farp2 T C 1: 93,576,524 F341S probably damaging Het
Fbn1 A G 2: 125,301,878 V2777A probably benign Het
Glcci1 T C 6: 8,573,186 I225T probably damaging Het
Gm3336 A G 8: 70,720,527 T63A unknown Het
Gm35339 T C 15: 76,361,487 V1308A Het
Gm8909 T G 17: 36,167,553 T168P probably damaging Het
Gm9767 A G 10: 26,078,783 T78A unknown Het
Habp4 T A 13: 64,176,046 M261K probably benign Het
Herc2 A G 7: 56,165,244 T2744A probably benign Het
Hlx A G 1: 184,732,026 V39A probably benign Het
Ifi204 G A 1: 173,760,206 T129I possibly damaging Het
Itfg1 A G 8: 85,725,568 I534T probably damaging Het
Klhl33 A T 14: 50,891,505 C496S probably benign Het
Lamb1 T A 12: 31,300,215 V713D possibly damaging Het
Mon2 G T 10: 123,016,308 H1052Q probably damaging Het
Ndst2 T C 14: 20,728,410 probably null Het
Nphp1 A T 2: 127,745,909 M582K probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr317 A G 11: 58,732,706 V153A possibly damaging Het
Olfr911-ps1 T A 9: 38,523,943 D70E probably damaging Het
Padi2 A T 4: 140,932,092 H236L probably benign Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Psenen T C 7: 30,562,078 I75V probably benign Het
Pycr1 A T 11: 120,642,920 M37K probably benign Het
Rpl4 T A 9: 64,177,930 N317K probably damaging Het
Scn8a T A 15: 101,016,962 probably null Het
Sdk1 A G 5: 142,127,847 T1550A probably damaging Het
Shisa6 G T 11: 66,375,164 T246K Het
Sis A T 3: 72,936,961 probably null Het
Slc22a14 A C 9: 119,170,638 S496A probably benign Het
Slc8a3 G A 12: 81,314,993 R351C probably damaging Het
Surf2 A G 2: 26,919,276 K202R probably benign Het
Tnxb T A 17: 34,717,010 probably null Het
Ugt2b36 T A 5: 87,092,124 N134I probably damaging Het
Xpr1 G A 1: 155,312,895 A333V possibly damaging Het
Zfp408 A T 2: 91,646,431 M126K probably benign Het
Zfy2 T C Y: 2,116,263 Q259R probably benign Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGCACATACGGTTGG -3'
(R):5'- GACTATGTTCTTGCAACCTCAC -3'

Sequencing Primer
(F):5'- GTAAGAACCGCTGTGCTGG -3'
(R):5'- TGCAACCTCACATCAATAAATTCTG -3'
Posted On 2020-09-15