Incidental Mutation 'R7985:Itfg1'
ID651433
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7985 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85725568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 534 (I534T)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably damaging
Transcript: ENSMUST00000034140
AA Change: I534T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: I534T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,664,349 S77R unknown Het
4933425L06Rik C T 13: 105,119,974 T517I probably benign Het
5830411N06Rik T A 7: 140,296,893 D732E probably damaging Het
Adamts1 T C 16: 85,798,114 Y582C probably damaging Het
Ahnak2 A T 12: 112,778,963 V683E Het
Allc T G 12: 28,553,972 T371P probably damaging Het
Ankrd12 A G 17: 65,984,196 I1414T probably benign Het
Bahcc1 A G 11: 120,272,891 K672E probably damaging Het
C3ar1 A T 6: 122,850,005 S418T probably damaging Het
C530008M17Rik T C 5: 76,658,050 V123A unknown Het
Calca A G 7: 114,635,178 V12A possibly damaging Het
Carmil3 A G 14: 55,496,952 E410G probably benign Het
Cfh A G 1: 140,108,826 F680S probably damaging Het
Csf3 G A 11: 98,702,447 G130D probably damaging Het
Cuedc1 A T 11: 88,182,516 Q169L probably benign Het
Cyp2c66 T A 19: 39,113,986 W20R probably null Het
Dguok C T 6: 83,480,932 E240K probably damaging Het
Dlg1 T G 16: 31,788,105 Y220* probably null Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Dnaic1 T C 4: 41,630,055 I488T probably benign Het
Dock1 G T 7: 134,746,954 C299F possibly damaging Het
Ebi3 C T 17: 55,953,997 T59M probably benign Het
Esrp1 G A 4: 11,367,153 S160F probably benign Het
Evi5l A G 8: 4,203,536 D471G probably benign Het
Farp2 T C 1: 93,576,524 F341S probably damaging Het
Fbn1 A G 2: 125,301,878 V2777A probably benign Het
Glcci1 T C 6: 8,573,186 I225T probably damaging Het
Gm3336 A G 8: 70,720,527 T63A unknown Het
Gm35339 T C 15: 76,361,487 V1308A Het
Gm8909 T G 17: 36,167,553 T168P probably damaging Het
Gm9767 A G 10: 26,078,783 T78A unknown Het
Habp4 T A 13: 64,176,046 M261K probably benign Het
Herc2 A G 7: 56,165,244 T2744A probably benign Het
Hlx A G 1: 184,732,026 V39A probably benign Het
Ifi204 G A 1: 173,760,206 T129I possibly damaging Het
Klhl33 A T 14: 50,891,505 C496S probably benign Het
Lamb1 T A 12: 31,300,215 V713D possibly damaging Het
Mon2 G T 10: 123,016,308 H1052Q probably damaging Het
Ndst2 T C 14: 20,728,410 probably null Het
Nphp1 A T 2: 127,745,909 M582K probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr317 A G 11: 58,732,706 V153A possibly damaging Het
Olfr911-ps1 T A 9: 38,523,943 D70E probably damaging Het
Padi2 A T 4: 140,932,092 H236L probably benign Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Psenen T C 7: 30,562,078 I75V probably benign Het
Pycr1 A T 11: 120,642,920 M37K probably benign Het
Rpl4 T A 9: 64,177,930 N317K probably damaging Het
Scn8a T A 15: 101,016,962 probably null Het
Sdk1 A G 5: 142,127,847 T1550A probably damaging Het
Shisa6 G T 11: 66,375,164 T246K Het
Sis A T 3: 72,936,961 probably null Het
Slc22a14 A C 9: 119,170,638 S496A probably benign Het
Slc8a3 G A 12: 81,314,993 R351C probably damaging Het
Surf2 A G 2: 26,919,276 K202R probably benign Het
Tnxb T A 17: 34,717,010 probably null Het
Ugt2b36 T A 5: 87,092,124 N134I probably damaging Het
Xpr1 G A 1: 155,312,895 A333V possibly damaging Het
Zfp408 A T 2: 91,646,431 M126K probably benign Het
Zfy2 T C Y: 2,116,263 Q259R probably benign Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTTATGAAACATCAGGTAGGTGTG -3'
(R):5'- TGCCTGCTAAAACTGTCTGATAAG -3'

Sequencing Primer
(F):5'- GGTACTCAGGGTAGGCAA -3'
(R):5'- ACTGTCTGATAAGTATTTGTCGAGTG -3'
Posted On2020-09-15