Mutagenetix > Incidental Mutation

Incidental Mutation 'R7986:Raph1'

651463

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R7986 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60496286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 73 (Y73C)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably damaging
Transcript: ENSMUST00000027168
AA Change: Y537C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: Y537C

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090293
AA Change: Y537C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: Y537C

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: Y485C

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: Y485C

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	G	T	16: 85,799,547	A401D	probably damaging	Het
Akap10	C	T	11: 61,930,064	G5R	probably damaging	Het
Arhgap21	A	C	2: 20,863,156	L1023W	probably damaging	Het
Bpifb4	A	G	2: 153,957,730	N339S	probably benign	Het
Btbd17	A	G	11: 114,792,515	Y124H	probably damaging	Het
Cacna1a	C	G	8: 84,638,779	R2184G	probably benign	Het
Cavin1	A	G	11: 100,970,276	I64T	probably damaging	Het
Cby3	A	G	11: 50,359,279	H9R	possibly damaging	Het
Ccdc141	A	G	2: 77,015,117	L1202P	probably benign	Het
Cd109	A	G	9: 78,688,766	I794V	possibly damaging	Het
Col12a1	C	T	9: 79,604,392		probably null	Het
Col6a2	A	G	10: 76,615,138	L23P	probably benign	Het
Csf1r	A	G	18: 61,114,832	H324R	probably benign	Het
D430041D05Rik	A	G	2: 104,256,751	S627P	probably damaging	Het
Dffb	G	A	4: 153,970,047	S195F	probably damaging	Het
Fstl5	T	A	3: 76,429,790	Y219N	probably damaging	Het
Gm13084	A	T	4: 143,812,020	L127*	probably null	Het
Gm29106	A	T	1: 118,200,270	H564L	possibly damaging	Het
Gm5771	T	C	6: 41,396,124	I110T	probably damaging	Het
Gpt2	T	A	8: 85,509,210	C158*	probably null	Het
Grin1	G	T	2: 25,295,829	A872D	probably damaging	Het
Hoxa1	T	C	6: 52,158,038	S62G	probably benign	Het
Krt28	T	C	11: 99,366,825	N397D	probably benign	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Llgl1	G	T	11: 60,711,395	A755S	probably benign	Het
Lmod2	A	G	6: 24,603,449	E141G	possibly damaging	Het
Loxhd1	A	T	18: 77,375,194	T910S	possibly damaging	Het
Masp2	A	G	4: 148,602,826	Y55C	probably damaging	Het
Nek10	A	C	14: 15,001,020	S1067R	probably benign	Het
Nemp2	C	T	1: 52,630,822	A22V	probably benign	Het
Npy2r	T	A	3: 82,541,496		probably null	Het
Nr1h4	A	T	10: 89,454,772	S469T	possibly damaging	Het
Nr4a3	T	C	4: 48,055,954	Y327H	probably damaging	Het
Olfr1113	A	G	2: 87,213,578	I229V	probably benign	Het
Olfr1437	C	T	19: 12,322,738	V30I	probably benign	Het
Ptpdc1	G	A	13: 48,592,570	A118V	probably damaging	Het
Rtl1	A	G	12: 109,592,058	S1116P	possibly damaging	Het
Secisbp2	T	C	13: 51,665,359	I325T	probably damaging	Het
Setd5	T	C	6: 113,128,457	S817P	probably benign	Het
Sirt6	A	G	10: 81,622,510	L303P	probably benign	Het
Slc46a2	G	T	4: 59,911,858	F451L	probably benign	Het
Sorbs1	T	A	19: 40,365,005	I219F	probably damaging	Het
Tmem178	A	G	17: 81,000,844	I223V	possibly damaging	Het
Trps1	T	G	15: 50,661,736	T933P	probably damaging	Het
Trps1	A	G	15: 50,889,623	F16S	probably benign	Het
Virma	T	A	4: 11,540,023	S1447R	probably benign	Het
Vmn1r230	T	C	17: 20,846,857	Y103H	probably damaging	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Ybx3	T	A	6: 131,379,399	R170*	probably null	Het
Zfp423	T	C	8: 87,780,350	D1122G	probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACCAGCAGAGTGATGAGC -3'
(R):5'- TGAGAACTTCCCAGGTAGAAAG -3'

Sequencing Primer
(F):5'- TGATGAGCATGAACAGTCAGACCC -3'
(R):5'- CTTCCCAGGTAGAAAGGTTTACATGG -3'

Posted On

2020-09-15