Incidental Mutation 'R7986:Nr4a3'
ID651474
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48055954 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 327 (Y327H)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: Y327H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: Y327H

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: Y356H

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G T 16: 85,799,547 A401D probably damaging Het
Akap10 C T 11: 61,930,064 G5R probably damaging Het
Arhgap21 A C 2: 20,863,156 L1023W probably damaging Het
Bpifb4 A G 2: 153,957,730 N339S probably benign Het
Btbd17 A G 11: 114,792,515 Y124H probably damaging Het
Cacna1a C G 8: 84,638,779 R2184G probably benign Het
Cavin1 A G 11: 100,970,276 I64T probably damaging Het
Cby3 A G 11: 50,359,279 H9R possibly damaging Het
Ccdc141 A G 2: 77,015,117 L1202P probably benign Het
Cd109 A G 9: 78,688,766 I794V possibly damaging Het
Col12a1 C T 9: 79,604,392 probably null Het
Col6a2 A G 10: 76,615,138 L23P probably benign Het
Csf1r A G 18: 61,114,832 H324R probably benign Het
D430041D05Rik A G 2: 104,256,751 S627P probably damaging Het
Dffb G A 4: 153,970,047 S195F probably damaging Het
Fstl5 T A 3: 76,429,790 Y219N probably damaging Het
Gm13084 A T 4: 143,812,020 L127* probably null Het
Gm29106 A T 1: 118,200,270 H564L possibly damaging Het
Gm5771 T C 6: 41,396,124 I110T probably damaging Het
Gpt2 T A 8: 85,509,210 C158* probably null Het
Grin1 G T 2: 25,295,829 A872D probably damaging Het
Hoxa1 T C 6: 52,158,038 S62G probably benign Het
Krt28 T C 11: 99,366,825 N397D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Llgl1 G T 11: 60,711,395 A755S probably benign Het
Lmod2 A G 6: 24,603,449 E141G possibly damaging Het
Loxhd1 A T 18: 77,375,194 T910S possibly damaging Het
Masp2 A G 4: 148,602,826 Y55C probably damaging Het
Nek10 A C 14: 15,001,020 S1067R probably benign Het
Nemp2 C T 1: 52,630,822 A22V probably benign Het
Npy2r T A 3: 82,541,496 probably null Het
Nr1h4 A T 10: 89,454,772 S469T possibly damaging Het
Olfr1113 A G 2: 87,213,578 I229V probably benign Het
Olfr1437 C T 19: 12,322,738 V30I probably benign Het
Ptpdc1 G A 13: 48,592,570 A118V probably damaging Het
Raph1 T C 1: 60,496,286 Y73C Het
Rtl1 A G 12: 109,592,058 S1116P possibly damaging Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Setd5 T C 6: 113,128,457 S817P probably benign Het
Sirt6 A G 10: 81,622,510 L303P probably benign Het
Slc46a2 G T 4: 59,911,858 F451L probably benign Het
Sorbs1 T A 19: 40,365,005 I219F probably damaging Het
Tmem178 A G 17: 81,000,844 I223V possibly damaging Het
Trps1 T G 15: 50,661,736 T933P probably damaging Het
Trps1 A G 15: 50,889,623 F16S probably benign Het
Virma T A 4: 11,540,023 S1447R probably benign Het
Vmn1r230 T C 17: 20,846,857 Y103H probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ybx3 T A 6: 131,379,399 R170* probably null Het
Zfp423 T C 8: 87,780,350 D1122G probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTTCACTGTCAGCCAGGAACAC -3'
(R):5'- GGAAAATGCACTGCCTCAATG -3'

Sequencing Primer
(F):5'- AAATTGTTTTTCCTGCAGGCTAGC -3'
(R):5'- TGCACTGCCTCAATGTAAATATTATC -3'
Posted On2020-09-15