Incidental Mutation 'R7986:Dffb'
ID651478
Institutional Source Beutler Lab
Gene Symbol Dffb
Ensembl Gene ENSMUSG00000029027
Gene NameDNA fragmentation factor, beta subunit
Synonyms5730477D02Rik, caspase-activated DNase, Didff, CAD, CPAN, DFF40, 40kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location153964449-153975126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153970047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 195 (S195F)
Ref Sequence ENSEMBL: ENSMUSP00000030893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000133607]
PDB Structure
NMR STRUCTURE OF THE CAD DOMAIN OF CASPASE-ACTIVATED DNASE [SOLUTION NMR]
NMR STRUCTURE OF THE HETERODIMERIC COMPLEX BETWEEN CAD DOMAINS OF CAD AND ICAD [SOLUTION NMR]
CRYSTAL STRUCTURE OF CASPASE-ACTIVATED DNASE (CAD) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030893
AA Change: S195F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027
AA Change: S195F

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal; however, mutant thymocytes and other cell types fail to undergo apoptotic DNA fragmentation in response to dexamethasone or other apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G T 16: 85,799,547 A401D probably damaging Het
Akap10 C T 11: 61,930,064 G5R probably damaging Het
Arhgap21 A C 2: 20,863,156 L1023W probably damaging Het
Bpifb4 A G 2: 153,957,730 N339S probably benign Het
Btbd17 A G 11: 114,792,515 Y124H probably damaging Het
Cacna1a C G 8: 84,638,779 R2184G probably benign Het
Cavin1 A G 11: 100,970,276 I64T probably damaging Het
Cby3 A G 11: 50,359,279 H9R possibly damaging Het
Ccdc141 A G 2: 77,015,117 L1202P probably benign Het
Cd109 A G 9: 78,688,766 I794V possibly damaging Het
Col12a1 C T 9: 79,604,392 probably null Het
Col6a2 A G 10: 76,615,138 L23P probably benign Het
Csf1r A G 18: 61,114,832 H324R probably benign Het
D430041D05Rik A G 2: 104,256,751 S627P probably damaging Het
Fstl5 T A 3: 76,429,790 Y219N probably damaging Het
Gm13084 A T 4: 143,812,020 L127* probably null Het
Gm29106 A T 1: 118,200,270 H564L possibly damaging Het
Gm5771 T C 6: 41,396,124 I110T probably damaging Het
Gpt2 T A 8: 85,509,210 C158* probably null Het
Grin1 G T 2: 25,295,829 A872D probably damaging Het
Hoxa1 T C 6: 52,158,038 S62G probably benign Het
Krt28 T C 11: 99,366,825 N397D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Llgl1 G T 11: 60,711,395 A755S probably benign Het
Lmod2 A G 6: 24,603,449 E141G possibly damaging Het
Loxhd1 A T 18: 77,375,194 T910S possibly damaging Het
Masp2 A G 4: 148,602,826 Y55C probably damaging Het
Nek10 A C 14: 15,001,020 S1067R probably benign Het
Nemp2 C T 1: 52,630,822 A22V probably benign Het
Npy2r T A 3: 82,541,496 probably null Het
Nr1h4 A T 10: 89,454,772 S469T possibly damaging Het
Nr4a3 T C 4: 48,055,954 Y327H probably damaging Het
Olfr1113 A G 2: 87,213,578 I229V probably benign Het
Olfr1437 C T 19: 12,322,738 V30I probably benign Het
Ptpdc1 G A 13: 48,592,570 A118V probably damaging Het
Raph1 T C 1: 60,496,286 Y73C Het
Rtl1 A G 12: 109,592,058 S1116P possibly damaging Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Setd5 T C 6: 113,128,457 S817P probably benign Het
Sirt6 A G 10: 81,622,510 L303P probably benign Het
Slc46a2 G T 4: 59,911,858 F451L probably benign Het
Sorbs1 T A 19: 40,365,005 I219F probably damaging Het
Tmem178 A G 17: 81,000,844 I223V possibly damaging Het
Trps1 T G 15: 50,661,736 T933P probably damaging Het
Trps1 A G 15: 50,889,623 F16S probably benign Het
Virma T A 4: 11,540,023 S1447R probably benign Het
Vmn1r230 T C 17: 20,846,857 Y103H probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ybx3 T A 6: 131,379,399 R170* probably null Het
Zfp423 T C 8: 87,780,350 D1122G probably benign Het
Other mutations in Dffb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Dffb APN 4 153965616 unclassified probably benign
R0243:Dffb UTSW 4 153965378 nonsense probably null
R0244:Dffb UTSW 4 153974615 missense probably benign 0.33
R2483:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3622:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3623:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3624:Dffb UTSW 4 153965519 missense probably damaging 1.00
R4562:Dffb UTSW 4 153965456 missense probably damaging 1.00
R4912:Dffb UTSW 4 153965407 unclassified probably benign
R5015:Dffb UTSW 4 153972959 missense possibly damaging 0.84
R5986:Dffb UTSW 4 153965593 missense probably damaging 1.00
R6950:Dffb UTSW 4 153970092 missense probably benign
R7395:Dffb UTSW 4 153969113 missense probably damaging 1.00
Z1176:Dffb UTSW 4 153972843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTACGGTACACTGCCAC -3'
(R):5'- TCTCACTGTAGAACTGGGCTGG -3'

Sequencing Primer
(F):5'- CCTCTTGGGTCATCGGCTG -3'
(R):5'- TAGAACTGGGCTGGGGCAG -3'
Posted On2020-09-15