Incidental Mutation 'R7986:Setd5'
ID651482
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113128457 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 817 (S817P)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably benign
Transcript: ENSMUST00000042889
AA Change: S798P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: S798P

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113155
AA Change: S817P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: S817P

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113157
AA Change: S817P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: S817P

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G T 16: 85,799,547 A401D probably damaging Het
Akap10 C T 11: 61,930,064 G5R probably damaging Het
Arhgap21 A C 2: 20,863,156 L1023W probably damaging Het
Bpifb4 A G 2: 153,957,730 N339S probably benign Het
Btbd17 A G 11: 114,792,515 Y124H probably damaging Het
Cacna1a C G 8: 84,638,779 R2184G probably benign Het
Cavin1 A G 11: 100,970,276 I64T probably damaging Het
Cby3 A G 11: 50,359,279 H9R possibly damaging Het
Ccdc141 A G 2: 77,015,117 L1202P probably benign Het
Cd109 A G 9: 78,688,766 I794V possibly damaging Het
Col12a1 C T 9: 79,604,392 probably null Het
Col6a2 A G 10: 76,615,138 L23P probably benign Het
Csf1r A G 18: 61,114,832 H324R probably benign Het
D430041D05Rik A G 2: 104,256,751 S627P probably damaging Het
Dffb G A 4: 153,970,047 S195F probably damaging Het
Fstl5 T A 3: 76,429,790 Y219N probably damaging Het
Gm13084 A T 4: 143,812,020 L127* probably null Het
Gm29106 A T 1: 118,200,270 H564L possibly damaging Het
Gm5771 T C 6: 41,396,124 I110T probably damaging Het
Gpt2 T A 8: 85,509,210 C158* probably null Het
Grin1 G T 2: 25,295,829 A872D probably damaging Het
Hoxa1 T C 6: 52,158,038 S62G probably benign Het
Krt28 T C 11: 99,366,825 N397D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Llgl1 G T 11: 60,711,395 A755S probably benign Het
Lmod2 A G 6: 24,603,449 E141G possibly damaging Het
Loxhd1 A T 18: 77,375,194 T910S possibly damaging Het
Masp2 A G 4: 148,602,826 Y55C probably damaging Het
Nek10 A C 14: 15,001,020 S1067R probably benign Het
Nemp2 C T 1: 52,630,822 A22V probably benign Het
Npy2r T A 3: 82,541,496 probably null Het
Nr1h4 A T 10: 89,454,772 S469T possibly damaging Het
Nr4a3 T C 4: 48,055,954 Y327H probably damaging Het
Olfr1113 A G 2: 87,213,578 I229V probably benign Het
Olfr1437 C T 19: 12,322,738 V30I probably benign Het
Ptpdc1 G A 13: 48,592,570 A118V probably damaging Het
Raph1 T C 1: 60,496,286 Y73C Het
Rtl1 A G 12: 109,592,058 S1116P possibly damaging Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sirt6 A G 10: 81,622,510 L303P probably benign Het
Slc46a2 G T 4: 59,911,858 F451L probably benign Het
Sorbs1 T A 19: 40,365,005 I219F probably damaging Het
Tmem178 A G 17: 81,000,844 I223V possibly damaging Het
Trps1 T G 15: 50,661,736 T933P probably damaging Het
Trps1 A G 15: 50,889,623 F16S probably benign Het
Virma T A 4: 11,540,023 S1447R probably benign Het
Vmn1r230 T C 17: 20,846,857 Y103H probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ybx3 T A 6: 131,379,399 R170* probably null Het
Zfp423 T C 8: 87,780,350 D1122G probably benign Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8271:Setd5 UTSW 6 113115070 missense possibly damaging 0.58
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
R8801:Setd5 UTSW 6 113150892 missense possibly damaging 0.95
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Z1191:Setd5 UTSW 6 113114996 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGACCCTGTCTAGAACCTATG -3'
(R):5'- ACTGATCCCTGACTCGAGATC -3'

Sequencing Primer
(F):5'- GACCCTGTCTAGAACCTATGTGAATG -3'
(R):5'- CGAGATCTTTCTCTTCCTCTGTAAAG -3'
Posted On2020-09-15