Incidental Mutation 'R7986:Akap10'
ID651494
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61930064 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 5 (G5R)
Ref Sequence ENSEMBL: ENSMUSP00000099710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102650] [ENSMUST00000108710]
Predicted Effect probably damaging
Transcript: ENSMUST00000102650
AA Change: G5R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: G5R

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108710
AA Change: G5R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: G5R

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G T 16: 85,799,547 A401D probably damaging Het
Arhgap21 A C 2: 20,863,156 L1023W probably damaging Het
Bpifb4 A G 2: 153,957,730 N339S probably benign Het
Btbd17 A G 11: 114,792,515 Y124H probably damaging Het
Cacna1a C G 8: 84,638,779 R2184G probably benign Het
Cavin1 A G 11: 100,970,276 I64T probably damaging Het
Cby3 A G 11: 50,359,279 H9R possibly damaging Het
Ccdc141 A G 2: 77,015,117 L1202P probably benign Het
Cd109 A G 9: 78,688,766 I794V possibly damaging Het
Col12a1 C T 9: 79,604,392 probably null Het
Col6a2 A G 10: 76,615,138 L23P probably benign Het
Csf1r A G 18: 61,114,832 H324R probably benign Het
D430041D05Rik A G 2: 104,256,751 S627P probably damaging Het
Dffb G A 4: 153,970,047 S195F probably damaging Het
Fstl5 T A 3: 76,429,790 Y219N probably damaging Het
Gm13084 A T 4: 143,812,020 L127* probably null Het
Gm29106 A T 1: 118,200,270 H564L possibly damaging Het
Gm5771 T C 6: 41,396,124 I110T probably damaging Het
Gpt2 T A 8: 85,509,210 C158* probably null Het
Grin1 G T 2: 25,295,829 A872D probably damaging Het
Hoxa1 T C 6: 52,158,038 S62G probably benign Het
Krt28 T C 11: 99,366,825 N397D probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Llgl1 G T 11: 60,711,395 A755S probably benign Het
Lmod2 A G 6: 24,603,449 E141G possibly damaging Het
Loxhd1 A T 18: 77,375,194 T910S possibly damaging Het
Masp2 A G 4: 148,602,826 Y55C probably damaging Het
Nek10 A C 14: 15,001,020 S1067R probably benign Het
Nemp2 C T 1: 52,630,822 A22V probably benign Het
Npy2r T A 3: 82,541,496 probably null Het
Nr1h4 A T 10: 89,454,772 S469T possibly damaging Het
Nr4a3 T C 4: 48,055,954 Y327H probably damaging Het
Olfr1113 A G 2: 87,213,578 I229V probably benign Het
Olfr1437 C T 19: 12,322,738 V30I probably benign Het
Ptpdc1 G A 13: 48,592,570 A118V probably damaging Het
Raph1 T C 1: 60,496,286 Y73C Het
Rtl1 A G 12: 109,592,058 S1116P possibly damaging Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Setd5 T C 6: 113,128,457 S817P probably benign Het
Sirt6 A G 10: 81,622,510 L303P probably benign Het
Slc46a2 G T 4: 59,911,858 F451L probably benign Het
Sorbs1 T A 19: 40,365,005 I219F probably damaging Het
Tmem178 A G 17: 81,000,844 I223V possibly damaging Het
Trps1 T G 15: 50,661,736 T933P probably damaging Het
Trps1 A G 15: 50,889,623 F16S probably benign Het
Virma T A 4: 11,540,023 S1447R probably benign Het
Vmn1r230 T C 17: 20,846,857 Y103H probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ybx3 T A 6: 131,379,399 R170* probably null Het
Zfp423 T C 8: 87,780,350 D1122G probably benign Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7867:Akap10 UTSW 11 61900446 missense probably damaging 1.00
R8079:Akap10 UTSW 11 61930054 missense possibly damaging 0.93
Z1186:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1187:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1188:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1189:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1190:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1191:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1192:Akap10 UTSW 11 61915270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTGGCCCAAAGCGACAATG -3'
(R):5'- CAAAGAGACGCTGTCATCCG -3'

Sequencing Primer
(F):5'- GCTTGAGGAGGCCACCTTC -3'
(R):5'- TGTCATCCGAAGCCTCCAG -3'
Posted On2020-09-15