Incidental Mutation 'R7986:Krt28'
ID 651495
Institutional Source Beutler Lab
Gene Symbol Krt28
Ensembl Gene ENSMUSG00000055937
Gene Name keratin 28
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7986 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99364872-99374903 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99366825 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 397 (N397D)
Ref Sequence ENSEMBL: ENSMUSP00000006963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006963]
AlphaFold A6BLY7
Predicted Effect probably benign
Transcript: ENSMUST00000006963
AA Change: N397D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006963
Gene: ENSMUSG00000055937
AA Change: N397D

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Filament 83 398 4.6e-144 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G T 16: 85,799,547 A401D probably damaging Het
Akap10 C T 11: 61,930,064 G5R probably damaging Het
Arhgap21 A C 2: 20,863,156 L1023W probably damaging Het
Bpifb4 A G 2: 153,957,730 N339S probably benign Het
Btbd17 A G 11: 114,792,515 Y124H probably damaging Het
Cacna1a C G 8: 84,638,779 R2184G probably benign Het
Cavin1 A G 11: 100,970,276 I64T probably damaging Het
Cby3 A G 11: 50,359,279 H9R possibly damaging Het
Ccdc141 A G 2: 77,015,117 L1202P probably benign Het
Cd109 A G 9: 78,688,766 I794V possibly damaging Het
Col12a1 C T 9: 79,604,392 probably null Het
Col6a2 A G 10: 76,615,138 L23P probably benign Het
Csf1r A G 18: 61,114,832 H324R probably benign Het
D430041D05Rik A G 2: 104,256,751 S627P probably damaging Het
Dffb G A 4: 153,970,047 S195F probably damaging Het
Fstl5 T A 3: 76,429,790 Y219N probably damaging Het
Gm13084 A T 4: 143,812,020 L127* probably null Het
Gm29106 A T 1: 118,200,270 H564L possibly damaging Het
Gm5771 T C 6: 41,396,124 I110T probably damaging Het
Gpt2 T A 8: 85,509,210 C158* probably null Het
Grin1 G T 2: 25,295,829 A872D probably damaging Het
Hoxa1 T C 6: 52,158,038 S62G probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Llgl1 G T 11: 60,711,395 A755S probably benign Het
Lmod2 A G 6: 24,603,449 E141G possibly damaging Het
Loxhd1 A T 18: 77,375,194 T910S possibly damaging Het
Masp2 A G 4: 148,602,826 Y55C probably damaging Het
Nek10 A C 14: 15,001,020 S1067R probably benign Het
Nemp2 C T 1: 52,630,822 A22V probably benign Het
Npy2r T A 3: 82,541,496 probably null Het
Nr1h4 A T 10: 89,454,772 S469T possibly damaging Het
Nr4a3 T C 4: 48,055,954 Y327H probably damaging Het
Olfr1113 A G 2: 87,213,578 I229V probably benign Het
Olfr1437 C T 19: 12,322,738 V30I probably benign Het
Ptpdc1 G A 13: 48,592,570 A118V probably damaging Het
Raph1 T C 1: 60,496,286 Y73C Het
Rtl1 A G 12: 109,592,058 S1116P possibly damaging Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Setd5 T C 6: 113,128,457 S817P probably benign Het
Sirt6 A G 10: 81,622,510 L303P probably benign Het
Slc46a2 G T 4: 59,911,858 F451L probably benign Het
Sorbs1 T A 19: 40,365,005 I219F probably damaging Het
Tmem178 A G 17: 81,000,844 I223V possibly damaging Het
Trps1 T G 15: 50,661,736 T933P probably damaging Het
Trps1 A G 15: 50,889,623 F16S probably benign Het
Virma T A 4: 11,540,023 S1447R probably benign Het
Vmn1r230 T C 17: 20,846,857 Y103H probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ybx3 T A 6: 131,379,399 R170* probably null Het
Zfp423 T C 8: 87,780,350 D1122G probably benign Het
Other mutations in Krt28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Krt28 APN 11 99371468 missense probably benign 0.00
IGL01568:Krt28 APN 11 99371417 missense probably damaging 1.00
IGL01590:Krt28 APN 11 99374394 critical splice donor site probably null
R1250:Krt28 UTSW 11 99366822 critical splice donor site probably null
R1488:Krt28 UTSW 11 99365171 missense probably benign 0.01
R2116:Krt28 UTSW 11 99365117 missense probably benign 0.27
R4244:Krt28 UTSW 11 99374550 missense probably damaging 1.00
R4862:Krt28 UTSW 11 99365110 missense possibly damaging 0.92
R4928:Krt28 UTSW 11 99374632 missense probably benign 0.00
R5035:Krt28 UTSW 11 99366824 missense probably benign 0.00
R5568:Krt28 UTSW 11 99371384 missense probably damaging 1.00
R5642:Krt28 UTSW 11 99374494 missense probably damaging 1.00
R5873:Krt28 UTSW 11 99366890 missense probably damaging 1.00
R6053:Krt28 UTSW 11 99371201 missense probably benign 0.05
R6548:Krt28 UTSW 11 99367013 missense probably damaging 1.00
R7194:Krt28 UTSW 11 99374404 nonsense probably null
R7863:Krt28 UTSW 11 99365173 missense possibly damaging 0.65
R8415:Krt28 UTSW 11 99374800 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCAGATTGGGGTCAGG -3'
(R):5'- TGCTAAGTAACTCAGGGCTGG -3'

Sequencing Primer
(F):5'- CAGTGCTTAACATGGATGGTAATG -3'
(R):5'- CTGGGTACTCCTCTGGTGAC -3'
Posted On 2020-09-15