Mutagenetix > Incidental Mutation

Incidental Mutation 'R7987:Triobp'

651552

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

046028-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79001544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1816 (Y1816N)

Ref Sequence

ENSEMBL: ENSMUSP00000105312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690]

AlphaFold

Q99KW3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109687
AA Change: Y429N

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: Y429N

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC
coiled coil region	339	377	N/A	INTRINSIC
coiled coil region	401	463	N/A	INTRINSIC
coiled coil region	497	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109689
AA Change: Y1770N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: Y1770N

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109690
AA Change: Y1816N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: Y1816N

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Meta Mutation Damage Score

0.0806

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	G	T	2: 32,574,305	Q161K	unknown	Het
Acsl5	T	C	19: 55,277,973		probably null	Het
Adgre1	T	A	17: 57,447,987	I695N	possibly damaging	Het
Ank2	T	C	3: 126,945,707	D2176G	unknown	Het
Atp6v0a2	G	A	5: 124,719,986	G810D	probably damaging	Het
Bod1l	A	C	5: 41,795,070	N2868K	probably damaging	Het
Brd7	T	C	8: 88,334,141	T526A	probably benign	Het
C9	T	A	15: 6,467,462	Y213*	probably null	Het
Cacna1i	G	A	15: 80,320,352		probably null	Het
Card6	T	A	15: 5,100,525	N463I	probably damaging	Het
Ccdc81	T	C	7: 89,876,111	Y485C	probably damaging	Het
Celsr1	A	G	15: 86,032,993	F260L	probably damaging	Het
Dnah8	A	G	17: 30,744,524	D2304G	probably damaging	Het
Dnase1	A	G	16: 4,037,970	D55G	probably damaging	Het
Ecsit	C	A	9: 22,073,484	R296L	probably damaging	Het
Entpd8	A	G	2: 25,084,766	D403G	probably damaging	Het
Epha2	C	A	4: 141,308,480	Q76K	probably damaging	Het
Exoc1	T	A	5: 76,543,585	V252E	probably damaging	Het
Fmnl3	T	A	15: 99,328,098	H225L	possibly damaging	Het
Gm4565	A	C	7: 22,583,387	M2R	probably benign	Het
Gpr146	G	T	5: 139,392,685	A81S	possibly damaging	Het
Heg1	C	A	16: 33,720,730	S419*	probably null	Het
Hps5	A	C	7: 46,769,051	I865S	probably benign	Het
Hsp90ab1	A	C	17: 45,571,606	I54S	probably damaging	Het
Hyal4	T	G	6: 24,763,866	M342R	probably damaging	Het
Itgal	A	G	7: 127,328,298	T987A	possibly damaging	Het
Kat6b	A	G	14: 21,669,863	T1428A	probably benign	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Lmtk2	A	G	5: 144,175,141	D893G	probably benign	Het
Mst1r	A	T	9: 107,912,798		probably null	Het
Mtus2	G	T	5: 148,232,026		probably null	Het
Myo3b	A	G	2: 70,330,933	T1174A	probably benign	Het
Nsun5	G	A	5: 135,375,680	R424H	probably damaging	Het
Oacyl	A	G	18: 65,698,391	E33G	probably benign	Het
Olfr77	T	C	9: 19,920,314	F35S	possibly damaging	Het
Olfr798	T	C	10: 129,625,969	I31V	probably benign	Het
Palm	C	T	10: 79,793,705		probably benign	Het
Papln	A	G	12: 83,775,382	E337G	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Setd1b	A	G	5: 123,147,680	D263G	unknown	Het
Slc10a7	T	A	8: 78,697,214	F202I	probably benign	Het
Smpd3	T	C	8: 106,259,894	I455V	probably benign	Het
Snip1	G	T	4: 125,066,939	G63W	probably damaging	Het
Sorl1	T	A	9: 41,977,561	Y1981F	probably damaging	Het
Tagln2	A	G	1: 172,505,253	T36A	probably benign	Het
Tnxb	T	C	17: 34,710,220	S2746P	possibly damaging	Het
Tob2	G	A	15: 81,851,480	P96L	probably damaging	Het
Trpc3	A	G	3: 36,644,169	I647T	probably benign	Het
Ttn	A	G	2: 76,891,561	S6600P	unknown	Het
Vmn1r200	A	T	13: 22,395,855	Y276F	possibly damaging	Het
Vmn1r230	T	C	17: 20,846,897	I116T	probably benign	Het
Vmn1r26	A	T	6: 58,008,279	Y308*	probably null	Het
Vmn2r16	C	T	5: 109,340,149	T296I	probably damaging	Het
Vmn2r50	T	C	7: 10,038,089	T562A	probably benign	Het
Wdfy2	A	G	14: 62,951,931	D283G	possibly damaging	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7972:Triobp	UTSW	15	78967986	missense	probably damaging	1.00
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R9424:Triobp	UTSW	15	78960066	missense	probably damaging	1.00
R9495:Triobp	UTSW	15	78993178	missense	probably damaging	1.00
R9514:Triobp	UTSW	15	78993178	missense	probably damaging	1.00
R9530:Triobp	UTSW	15	79002121	missense	probably damaging	1.00
R9550:Triobp	UTSW	15	78973877	missense	probably damaging	1.00
R9576:Triobp	UTSW	15	78960066	missense	probably damaging	1.00
R9646:Triobp	UTSW	15	79003734	missense	probably damaging	1.00
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
RF058:Triobp	UTSW	15	78967044	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGACCAGCTCTCACAAAGC -3'
(R):5'- CAGCTCTGGGAGACACTAAAGG -3'

Sequencing Primer
(F):5'- TCACAAAGCCACTGGGTTCAGG -3'
(R):5'- GACTCATGTGATCTCTGCCAAGG -3'

Posted On

2020-09-15