Incidental Mutation 'R7988:Cfap45'
ID651568
Institutional Source Beutler Lab
Gene Symbol Cfap45
Ensembl Gene ENSMUSG00000026546
Gene Namecilia and flagella associated protein 45
Synonyms1700028D05Rik, Nesg1, Ccdc19
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172520801-172545870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172529934 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000083057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085894] [ENSMUST00000159395] [ENSMUST00000159792] [ENSMUST00000161140] [ENSMUST00000162988]
Predicted Effect probably damaging
Transcript: ENSMUST00000085894
AA Change: D85G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083057
Gene: ENSMUSG00000026546
AA Change: D85G

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:TPH 187 532 1.5e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159395
AA Change: D56G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125224
Gene: ENSMUSG00000026546
AA Change: D56G

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159792
AA Change: D56G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124540
Gene: ENSMUSG00000026546
AA Change: D56G

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161140
AA Change: D43G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000162988
AA Change: D56G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.7480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Cfap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cfap45 APN 1 172535345 unclassified probably benign
IGL01936:Cfap45 APN 1 172534049 missense probably damaging 1.00
IGL03235:Cfap45 APN 1 172538493 missense possibly damaging 0.55
R0194:Cfap45 UTSW 1 172541327 missense probably benign 0.05
R0883:Cfap45 UTSW 1 172532189 missense possibly damaging 0.90
R1130:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1168:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1356:Cfap45 UTSW 1 172527863 missense possibly damaging 0.53
R1522:Cfap45 UTSW 1 172540572 missense probably damaging 1.00
R1921:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R1922:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R2203:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2204:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2205:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R3156:Cfap45 UTSW 1 172545724 missense possibly damaging 0.93
R4059:Cfap45 UTSW 1 172538489 missense probably benign 0.00
R4151:Cfap45 UTSW 1 172532221 missense probably damaging 0.98
R4445:Cfap45 UTSW 1 172535227 missense probably benign 0.07
R4548:Cfap45 UTSW 1 172545108 missense probably benign 0.00
R4582:Cfap45 UTSW 1 172529912 missense probably benign 0.42
R4909:Cfap45 UTSW 1 172529876 missense probably benign 0.14
R5200:Cfap45 UTSW 1 172545129 nonsense probably null
R5800:Cfap45 UTSW 1 172538600 missense probably damaging 0.98
R6520:Cfap45 UTSW 1 172540584 missense probably damaging 1.00
R6662:Cfap45 UTSW 1 172529850 missense probably benign 0.01
R7378:Cfap45 UTSW 1 172538343 splice site probably null
R7390:Cfap45 UTSW 1 172541358 missense probably benign 0.00
R7468:Cfap45 UTSW 1 172535310 nonsense probably null
R7545:Cfap45 UTSW 1 172538596 missense probably benign
R8212:Cfap45 UTSW 1 172541500 splice site probably null
R8272:Cfap45 UTSW 1 172527839 missense possibly damaging 0.53
R8939:Cfap45 UTSW 1 172545267 missense probably damaging 1.00
Z1176:Cfap45 UTSW 1 172545284 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGCCTCAAGGTCCGTATTG -3'
(R):5'- ACGAAATCCAGTTTTGTGTACG -3'

Sequencing Primer
(F):5'- CCTCAAGGTCCGTATTGGGTCAG -3'
(R):5'- ATCCAGTTTTGTGTACGTTAAGC -3'
Posted On2020-09-15