Incidental Mutation 'R7988:Dnah14'
ID 651569
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181783574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3755 (D3755G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: D3755G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
R8520:Dnah14 UTSW 1 181653638 missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181664946 missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181666011 nonsense probably null
R8710:Dnah14 UTSW 1 181690311 missense probably benign 0.04
R8752:Dnah14 UTSW 1 181628016 missense probably benign 0.00
R8792:Dnah14 UTSW 1 181814624 missense
R8797:Dnah14 UTSW 1 181637847 missense probably benign 0.19
R8821:Dnah14 UTSW 1 181792004 nonsense probably null
R8834:Dnah14 UTSW 1 181616750 missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181725498 missense probably benign 0.01
R8925:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181622723 missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9169:Dnah14 UTSW 1 181605816 missense probably benign 0.06
R9199:Dnah14 UTSW 1 181651001 missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181801287 missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181616640 critical splice donor site probably null
R9271:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9282:Dnah14 UTSW 1 181814512 missense
R9350:Dnah14 UTSW 1 181734804 missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181709033 missense probably benign 0.01
R9436:Dnah14 UTSW 1 181680783 missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181690208 missense probably benign 0.45
R9484:Dnah14 UTSW 1 181797746 missense probably benign 0.01
R9486:Dnah14 UTSW 1 181680929 missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181674442 missense probably benign 0.16
R9654:Dnah14 UTSW 1 181766339 missense probably benign 0.01
R9681:Dnah14 UTSW 1 181734849 missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181598944 missense probably benign 0.01
R9687:Dnah14 UTSW 1 181598413 missense probably benign 0.01
R9718:Dnah14 UTSW 1 181622979 missense probably benign 0.08
R9751:Dnah14 UTSW 1 181792045 missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181685784 missense probably benign 0.03
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGGTAGCTGGAGATG -3'
(R):5'- TCAGTTTATGAGATGCCAGGAC -3'

Sequencing Primer
(F):5'- CAAGGTAGCTGGAGATGGGAGTG -3'
(R):5'- CAGGACTGTGAGGTAGCGTC -3'
Posted On 2020-09-15