Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Eprs'

651570

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 185418348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1349 (Y1349C)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514]

AlphaFold

Q8CGC7

Predicted Effect

probably damaging
Transcript: ENSMUST00000046514
AA Change: Y1349C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: Y1349C

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0179:Eprs	UTSW	1	185413547	missense	probably benign
R0783:Eprs	UTSW	1	185398458	missense	probably damaging	1.00
R1319:Eprs	UTSW	1	185384962	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6647:Eprs	UTSW	1	185414424	missense	probably damaging	1.00
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00
R7729:Eprs	UTSW	1	185413169	missense	probably damaging	1.00
R7732:Eprs	UTSW	1	185372939	missense	probably benign	0.01
R7733:Eprs	UTSW	1	185397161	missense	probably benign
R7826:Eprs	UTSW	1	185406968	missense	probably damaging	0.96
R8071:Eprs	UTSW	1	185394456	missense	possibly damaging	0.67
R8157:Eprs	UTSW	1	185398394	missense	probably benign	0.21
R8209:Eprs	UTSW	1	185407615	missense	possibly damaging	0.71
R8370:Eprs	UTSW	1	185399257	missense	probably damaging	0.98
R8493:Eprs	UTSW	1	185407174	nonsense	probably null
R8556:Eprs	UTSW	1	185420288	critical splice donor site	probably null
R8877:Eprs	UTSW	1	185415874	nonsense	probably null
R9096:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9097:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9112:Eprs	UTSW	1	185397076	missense	probably damaging	1.00
R9189:Eprs	UTSW	1	185374137	missense	possibly damaging	0.89
R9489:Eprs	UTSW	1	185407698	missense	probably benign	0.20
R9489:Eprs	UTSW	1	185407699	missense	probably benign	0.00
R9518:Eprs	UTSW	1	185379566	missense	probably benign	0.00
R9586:Eprs	UTSW	1	185407549	missense

Predicted Primers

PCR Primer
(F):5'- CATTGGCAGATTTTAACTTCTGTATGG -3'
(R):5'- TTCTCCTTGAACCACCACAG -3'

Sequencing Primer
(F):5'- ACTTCTGTATGGTTCATTATTGTAGG -3'
(R):5'- TGAACCACCACAGAGAGTAGTTTAAC -3'

Posted On

2020-09-15