Incidental Mutation 'R7988:Cubn'
ID 651571
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin
Synonyms D2Wsu88e, intrinsic factor-cobalamin receptor
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 13281149-13496624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13337166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2437 (T2437A)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000091436
AA Change: T2437A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: T2437A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Meta Mutation Damage Score 0.1849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,496,631 (GRCm39) unclassified probably benign
IGL00228:Cubn APN 2 13,461,508 (GRCm39) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,386,660 (GRCm39) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,431,867 (GRCm39) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,283,229 (GRCm39) missense probably benign 0.00
IGL00519:Cubn APN 2 13,287,730 (GRCm39) missense probably benign 0.00
IGL00562:Cubn APN 2 13,299,041 (GRCm39) missense probably benign 0.01
IGL00678:Cubn APN 2 13,472,521 (GRCm39) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,386,738 (GRCm39) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,461,434 (GRCm39) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,283,219 (GRCm39) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,482,904 (GRCm39) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,315,377 (GRCm39) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,470,719 (GRCm39) missense probably benign 0.31
IGL01418:Cubn APN 2 13,288,852 (GRCm39) missense probably benign 0.01
IGL01450:Cubn APN 2 13,355,673 (GRCm39) splice site probably benign
IGL01534:Cubn APN 2 13,470,744 (GRCm39) nonsense probably null
IGL01584:Cubn APN 2 13,313,472 (GRCm39) splice site probably benign
IGL01595:Cubn APN 2 13,330,027 (GRCm39) missense probably benign 0.05
IGL01625:Cubn APN 2 13,311,085 (GRCm39) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,494,747 (GRCm39) nonsense probably null
IGL01972:Cubn APN 2 13,450,883 (GRCm39) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,292,405 (GRCm39) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,344,657 (GRCm39) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,386,648 (GRCm39) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,432,645 (GRCm39) splice site probably null
IGL02491:Cubn APN 2 13,326,039 (GRCm39) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,330,037 (GRCm39) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,450,843 (GRCm39) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,449,851 (GRCm39) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,299,181 (GRCm39) missense probably benign 0.07
IGL02897:Cubn APN 2 13,323,123 (GRCm39) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,291,905 (GRCm39) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,360,500 (GRCm39) missense probably benign 0.09
IGL03289:Cubn APN 2 13,431,778 (GRCm39) missense probably benign 0.00
IGL03335:Cubn APN 2 13,365,140 (GRCm39) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,482,868 (GRCm39) splice site probably null
mellow UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,473,663 (GRCm39) nonsense probably null
PIT4495001:Cubn UTSW 2 13,496,561 (GRCm39) missense probably benign 0.00
R0145:Cubn UTSW 2 13,311,243 (GRCm39) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,361,520 (GRCm39) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,480,846 (GRCm39) critical splice donor site probably null
R0254:Cubn UTSW 2 13,445,325 (GRCm39) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,429,505 (GRCm39) missense probably benign 0.01
R0360:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0364:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0383:Cubn UTSW 2 13,435,770 (GRCm39) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,474,575 (GRCm39) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,474,574 (GRCm39) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,449,078 (GRCm39) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,433,491 (GRCm39) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,365,063 (GRCm39) splice site probably null
R0735:Cubn UTSW 2 13,496,500 (GRCm39) splice site probably benign
R0780:Cubn UTSW 2 13,461,424 (GRCm39) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,367,139 (GRCm39) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,341,053 (GRCm39) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,449,811 (GRCm39) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,365,130 (GRCm39) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,480,931 (GRCm39) missense probably benign 0.04
R1508:Cubn UTSW 2 13,431,916 (GRCm39) missense probably benign 0.25
R1532:Cubn UTSW 2 13,292,472 (GRCm39) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,432,778 (GRCm39) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,474,600 (GRCm39) missense probably benign 0.00
R1761:Cubn UTSW 2 13,494,128 (GRCm39) critical splice donor site probably null
R1862:Cubn UTSW 2 13,313,372 (GRCm39) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,327,813 (GRCm39) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,315,337 (GRCm39) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,283,349 (GRCm39) missense probably benign 0.01
R1960:Cubn UTSW 2 13,344,828 (GRCm39) splice site probably null
R2021:Cubn UTSW 2 13,313,360 (GRCm39) missense probably benign 0.09
R2137:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2138:Cubn UTSW 2 13,449,189 (GRCm39) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2179:Cubn UTSW 2 13,323,053 (GRCm39) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,408,891 (GRCm39) nonsense probably null
R2369:Cubn UTSW 2 13,496,028 (GRCm39) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,480,961 (GRCm39) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,323,083 (GRCm39) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,283,167 (GRCm39) splice site probably null
R2850:Cubn UTSW 2 13,327,764 (GRCm39) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,435,645 (GRCm39) missense probably benign 0.00
R2893:Cubn UTSW 2 13,362,950 (GRCm39) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,362,973 (GRCm39) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,338,319 (GRCm39) missense probably benign 0.00
R3703:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,336,396 (GRCm39) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,432,725 (GRCm39) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,365,164 (GRCm39) missense probably benign 0.01
R3813:Cubn UTSW 2 13,299,136 (GRCm39) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,291,791 (GRCm39) critical splice donor site probably null
R3921:Cubn UTSW 2 13,331,488 (GRCm39) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,318,810 (GRCm39) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,433,374 (GRCm39) intron probably benign
R4405:Cubn UTSW 2 13,470,841 (GRCm39) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,433,560 (GRCm39) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,318,790 (GRCm39) splice site probably null
R4770:Cubn UTSW 2 13,319,578 (GRCm39) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,355,869 (GRCm39) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,291,835 (GRCm39) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,463,887 (GRCm39) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,330,036 (GRCm39) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,494,721 (GRCm39) missense probably benign 0.06
R4967:Cubn UTSW 2 13,352,856 (GRCm39) missense probably benign 0.01
R5187:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,483,013 (GRCm39) nonsense probably null
R5305:Cubn UTSW 2 13,393,750 (GRCm39) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,496,506 (GRCm39) splice site probably null
R5530:Cubn UTSW 2 13,313,334 (GRCm39) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,355,743 (GRCm39) missense probably benign 0.00
R5737:Cubn UTSW 2 13,393,702 (GRCm39) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,324,834 (GRCm39) splice site probably benign
R5923:Cubn UTSW 2 13,490,889 (GRCm39) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6084:Cubn UTSW 2 13,435,708 (GRCm39) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,313,429 (GRCm39) missense probably benign 0.29
R6181:Cubn UTSW 2 13,354,687 (GRCm39) missense probably benign 0.31
R6301:Cubn UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,285,006 (GRCm39) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,480,934 (GRCm39) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,435,806 (GRCm39) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,432,646 (GRCm39) critical splice donor site probably null
R6393:Cubn UTSW 2 13,360,491 (GRCm39) missense probably benign 0.08
R6408:Cubn UTSW 2 13,299,014 (GRCm39) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,463,813 (GRCm39) missense probably benign 0.01
R6599:Cubn UTSW 2 13,315,484 (GRCm39) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,435,683 (GRCm39) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,480,875 (GRCm39) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,326,066 (GRCm39) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,449,840 (GRCm39) missense probably benign 0.21
R6847:Cubn UTSW 2 13,449,064 (GRCm39) critical splice donor site probably null
R6885:Cubn UTSW 2 13,323,089 (GRCm39) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,352,840 (GRCm39) missense probably benign 0.03
R6973:Cubn UTSW 2 13,386,648 (GRCm39) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,491,600 (GRCm39) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,311,092 (GRCm39) missense probably benign 0.10
R7076:Cubn UTSW 2 13,311,091 (GRCm39) missense probably benign 0.00
R7086:Cubn UTSW 2 13,324,669 (GRCm39) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,347,309 (GRCm39) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,355,814 (GRCm39) missense probably benign 0.01
R7292:Cubn UTSW 2 13,429,550 (GRCm39) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,345,143 (GRCm39) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,473,582 (GRCm39) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,291,875 (GRCm39) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,431,778 (GRCm39) missense probably benign 0.00
R7429:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,460,320 (GRCm39) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7700:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7751:Cubn UTSW 2 13,365,176 (GRCm39) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,284,889 (GRCm39) missense probably benign 0.11
R7759:Cubn UTSW 2 13,352,961 (GRCm39) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,473,680 (GRCm39) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,429,538 (GRCm39) missense probably benign 0.22
R8010:Cubn UTSW 2 13,340,897 (GRCm39) critical splice donor site probably null
R8020:Cubn UTSW 2 13,483,989 (GRCm39) missense probably benign 0.01
R8120:Cubn UTSW 2 13,336,471 (GRCm39) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,393,659 (GRCm39) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,299,129 (GRCm39) missense probably benign 0.11
R8224:Cubn UTSW 2 13,354,688 (GRCm39) missense probably benign 0.16
R8289:Cubn UTSW 2 13,491,613 (GRCm39) missense probably benign 0.10
R8326:Cubn UTSW 2 13,311,274 (GRCm39) missense probably benign 0.01
R8331:Cubn UTSW 2 13,345,053 (GRCm39) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,435,658 (GRCm39) missense probably benign 0.08
R8341:Cubn UTSW 2 13,433,535 (GRCm39) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,329,971 (GRCm39) missense probably benign 0.17
R8427:Cubn UTSW 2 13,433,567 (GRCm39) missense probably benign 0.00
R8432:Cubn UTSW 2 13,386,610 (GRCm39) missense probably benign 0.00
R8441:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,318,855 (GRCm39) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,313,331 (GRCm39) critical splice donor site probably null
R8699:Cubn UTSW 2 13,388,770 (GRCm39) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,313,377 (GRCm39) nonsense probably null
R8874:Cubn UTSW 2 13,365,157 (GRCm39) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,461,466 (GRCm39) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,291,914 (GRCm39) missense probably benign 0.02
R9143:Cubn UTSW 2 13,337,276 (GRCm39) splice site probably benign
R9261:Cubn UTSW 2 13,283,262 (GRCm39) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,386,703 (GRCm39) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,463,767 (GRCm39) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,292,510 (GRCm39) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,482,945 (GRCm39) missense probably benign 0.00
R9615:Cubn UTSW 2 13,325,991 (GRCm39) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,319,529 (GRCm39) missense probably benign 0.04
R9774:Cubn UTSW 2 13,433,530 (GRCm39) missense probably benign
X0018:Cubn UTSW 2 13,463,797 (GRCm39) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,480,887 (GRCm39) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,347,392 (GRCm39) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,327,773 (GRCm39) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,388,803 (GRCm39) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,299,040 (GRCm39) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,386,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATTGCCTTTTATCTTGTAAGAGCC -3'
(R):5'- TTCATTGACAAAAGATGGCCTC -3'

Sequencing Primer
(F):5'- GCCAAGAAGAGAGCATCACATTTTC -3'
(R):5'- GGTTTTCTTTGTCCATGCAAAACAG -3'
Posted On 2020-09-15