Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Notch1'

651572

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 26471001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1111 (D1111N)

Ref Sequence

ENSEMBL: ENSMUSP00000028288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]

AlphaFold

Q01705

PDB Structure

The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028288
AA Change: D1111N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: D1111N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132820

Meta Mutation Damage Score

0.1049

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0013:Notch1	UTSW	2	26473818	missense	possibly damaging	0.64
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6161:Notch1	UTSW	2	26468731	missense	probably damaging	1.00
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6209:Notch1	UTSW	2	26472805	missense	probably damaging	1.00
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6493:Notch1	UTSW	2	26472098	missense	unknown
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R6736:Notch1	UTSW	2	26460286	missense	probably benign	0.01
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
R9270:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9463:Notch1	UTSW	2	26469833	missense	probably benign	0.20
R9546:Notch1	UTSW	2	26481115	missense	probably damaging	0.97
R9674:Notch1	UTSW	2	26471296	missense	probably damaging	0.98
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AAAGCCGCCGAGATAGTCAG -3'
(R):5'- GTCTCCTCAGAACCTTGTGC -3'

Sequencing Primer
(F):5'- ATAGTCAGTGCAGGTAGCTCCATTC -3'
(R):5'- ACTCGGCTCCCTGCAAGAATG -3'

Posted On

2020-09-15